Mutants (Isolated)

tm332

Allele Nametm332
Sequence NameF44F4.10
CGC NameF44F4.10
Worm BaseAllele Name tm332
CGC Name F44F4.10
Sequence F44F4.10
Phenotypehomozygous viable
Mutation site37165/37166-37709/37710 (544 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(36691..37057,37383..37672,37730..37858,37917..37973))
Map position3.13
Balancer
Map position of balancer
Sequence of primersExtRev:TCCGGCAATTTGCCGACTTG,ExtFwd:AAAGTCTTTCTCTCAGCGCC,IntRev:GCTGGTCAATCCCATAGATA,IntFwd:GGTCTGTTCAAATGTCCTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McGovern M, Yu L, Kosinski M, Greenstein D, Savage-Dunn C.
A role for sperm in regulation of egg-laying in the nematode C. elegans.
BMC Dev Biol 2007 7 41 
[ PubMed ID = 17472754 ] [ RRC reference ]