Mutants (Isolated)

tm329

Allele Nametm329
Sequence NameT07D4.3
CGC Namerha-1
Worm BaseAllele Name tm329
CGC Name rha-1
Sequence T07D4.3
Phenotypehomozygous viable. Dr. R. Plasterk: Genes & Dev. 19, 782-(2005).
Mutation site19357/19358-20416/20417 (1059 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(15765..16048, 16545..16577, 16627..16690, 16737..16953, 17004..17411, 17470..18144, 18190..18358, 18404..18748, 18798..18972, 19019..19507, 19556..19816, 19869..20005, 20057..20103, 20161..20591, 20635..20805, 21104..21238, 21284..21451)
Map position0.92
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCCCAACCGGGAAGAAAAA,IntRev:CCATCAAAAAGAGTTACGCG,ExtRev:AACAACGCAAAAACACCGCA,IntFwd:AAAACGGCGCCATCCACTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Walstrom KM, Schmidt D, Bean CJ, Kelly WG.
RNA helicase A is important for germline transcriptional control, proliferation, and meiosis in C. elegans.
Mech. Dev. 2005 122(5) 707-20 
[ PubMed ID = 15817227 ] [ RRC reference ]

Robert VJ, Sijen T, van Wolfswinkel J, Plasterk RH.
Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences.
Genes Dev. 2005 19(7) 782-7 
[ PubMed ID = 15774721 ] [ RRC reference ]