Mutants (Isolated)

tm327

Allele Nametm327
Sequence NameB0303.9
CGC Namevps-33.1
Worm BaseAllele Name tm327
CGC Name vps-33.1
Sequence B0303.9
Phenotypematernal, embryonic lethal. Dr. G. Hermann: unable to find lethals. Dr. G. Ruvkun: no effect on dauer arrest. Dr. C. Yang: slightly Dpy, cell corpses degradation defects.
Mutation site21444/21445-22118/22119 (674 bp deletion)
ChromosomeIII
Putative gene structurejoin(20715..20771, 20828..20950, 21008..21169, 21342..21439, 21533..22043, 22090..22252, 22299..22915)
Map position-0.11
Balancerdpy-13 or eT1 IV
Map position of balancer0
Sequence of primersExtRev:CGGATGGATCGATATGCTCT,IntFwd:GACTCGGTGTTTGGGAAGAC,ExtFwd:ATGCTAGAAGGCGCACTGTT,IntRev:GAGTCGGACGACGATTGATT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kage-Nakadai E, Yoshina S, Otori M, Kagawa-Nagamura Y, Nakai J, Mitani S.
Distinct roles of the two VPS33 proteins in the endolysosomal system in Caenorhabditis elegans.
Traffic 2016 17(11) 1197-1213 
[ PubMed ID = 27558849 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]

Xiao H, Chen D, Fang Z, Xu J, Sun X, Song S, Liu J, Yang C.
Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans.
Mol Biol Cell 2009 20(1) 21-32 
[ PubMed ID = 18923146 ] [ RRC reference ]