Mutants (Isolated)

tm3268

Allele Nametm3268
Sequence NameF58G6.4
CGC Nameacc-1
Worm BaseAllele Name tm3268
CGC Name acc-1
Sequence F58G6.4
Phenotypehomozygous viable. Dr. H. Sawa: not Psa. Dr. C. Bargmann: reduced locomotion on food.
Mutation site22068/22069-TCGA-22309/22310 (241 bp deletion + 4 bp insertion)
ChromosomeIV
Putative gene structurejoin(21216..21356, 21403..21496, 21644..21809, 21970..22101, 22250..22373, 22457..22536, 22588..22647, 22789..22996, 23190..23276, 23325..23390, 23659..23789, 23944..23985, 24036..24105)
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntRev:CAACTCACTTTAGGCGGTAG,IntFwd:CCGGGTTGGATTATGGTGTC,ExtRev:GTGCGGACTAGTTTGCATAC,ExtFwd:TTAGATGAGTCATCCGGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Z, Liu J, Zheng M, Xu XZ.
Encoding of both analog- and digital-like behavioral outputs by one C. elegans interneuron.
Cell 2014 159(4) 751-65 
[ PubMed ID = 25417153 ] [ RRC reference ]

Takayanagi-Kiya S, Zhou K, Jin Y.
Release-dependent feedback inhibition by a presynaptically localized ligand-gated anion channel.
Elife 2016 5  
[ PubMed ID = 27782882 ] [ RRC reference ]