Mutants (Isolated)

tm326

Allele Nametm326
Sequence NameF10D2.9
CGC Namefat-7
Worm BaseAllele Name tm326
CGC Name fat-7
Sequence F10D2.9
Phenotypelethal? (maintenance: +/eT1 III; tm326/eT1 V = FX326)Dpy, slow growth? Dr. K. Sakamoto: J. Biochem 144, 149 (2008)
Mutation site21229/21230-CAATCATATATCACTTGCC-21955/21956 (726 bp deletion + 20 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(19393..19672, 19943..20104, 20153..20489, 20728..20848, 20961..21077))
Map position-1.33
BalancereT1
Map position of balancer
Sequence of primersExtRev:TTATTGATCAAGCTACACGTATTA,IntRev:CCTGTAGTTTGCTTCTTCTCATTT,IntFwd:ATAAACTCATCGGCAATTGTTTTT,ExtFwd:GGCAACCTGCCGGCTGATAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horikawa M, Sakamoto K.
Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans.
Mol. Cell. Endocrinol. 2010 323(2) 183-92 
[ PubMed ID = 20226839 ] [ RRC reference ]

Brock TJ, Browse J, Watts JL.
Genetic regulation of unsaturated fatty acid composition in C. elegans.
PLoS Genet. 2006 2(7) e108 
[ PubMed ID = 16839188 ] [ RRC reference ]