Allele Name | tm326 |
Allele Type | バランス済 |
Sequence Name | F10D2.9 |
Gene Name | fat-7 |
Worm Base | Allele Name |
tm326
|
Gene Name |
fat-7
|
Sequence |
F10D2.9
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal? (maintenance: +/eT1 III; tm326/eT1 V = FX326)Dpy, slow growth? Dr. K. Sakamoto: J. Biochem 144, 149 (2008) |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 21229/21230-CAATCATATATCACTTGCC-21955/21956 (726 bp deletion + 20 bp insertion) |
Chromosome | V |
Putative gene structure | complement(join(19393..19672, 19943..20104, 20153..20489, 20728..20848, 20961..21077)) |
Map position | -1.33 |
Balancer | eT1 |
Map position of balancer | |
Sequence of primers | ExtRev:TTATTGATCAAGCTACACGTATTA,IntRev:CCTGTAGTTTGCTTCTTCTCATTT,IntFwd:ATAAACTCATCGGCAATTGTTTTT,ExtFwd:GGCAACCTGCCGGCTGATAA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Horikawa M, Sakamoto K. Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans. Mol Cell Endocrinol 2010 323(2) 183-92
[ PubMed ID = 20226839 ]
[ RRC reference ]
|
Brock TJ, Browse J, Watts JL. Genetic regulation of unsaturated fatty acid composition in C. elegans. PLoS Genet 2006 2(7) e108
[ PubMed ID = 16839188 ]
[ RRC reference ]
|
|