Mutants (Isolated)

tm3256

Allele Nametm3256
Sequence NameH25K10.5
CGC NameH25K10.5
Worm BaseAllele Name tm3256
CGC Name H25K10.5
Sequence H25K10.5
Phenotypehomozygous viable.
Mutation site29052/29053-29662/29663 (610 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(27130..27215, 27274..27403, 27449..27516, 27569..27947, 28769..29052, 29101..29295, 29353..29601, 29647..29806))
Map position14.62
Balancer
Map position of balancer
Sequence of primersIntRev:CCATGAGCAATATTACCCGA,IntFwd:CGGTTATCTAGGTGTGGCCT,ExtRev:CTACATCCAGTGATGGTCTT,ExtFwd:CCTAACGCATACTACCGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Detienne G, De Haes W, Ernst UR, Schoofs L, Temmerman L.
Royalactin extends lifespan of Caenorhabditis elegans through epidermal growth factor signaling.
Exp. Gerontol. 2014 60 129-35 
[ PubMed ID = 25456847 ] [ RRC reference ]

Yu S, Driscoll M.
EGF signaling comes of age: promotion of healthy aging in C. elegans.
Exp. Gerontol. 2011 46(2-3) 129-34 
[ PubMed ID = 21074601 ] [ RRC reference ]

Iwasa H, Yu S, Xue J, Driscoll M.
Novel EGF pathway regulators modulate C. elegans healthspan and lifespan via EGF receptor, PLC-gamma, and IP3R activation.
Aging Cell 2010 9(4) 490-505 
[ PubMed ID = 20497132 ] [ RRC reference ]