Mutants (Isolated)

tm3241

Allele Nametm3241
Sequence NameW03D2.4
CGC Namepcn-1
Worm BaseAllele Name tm3241
CGC Name pcn-1
Sequence W03D2.4
Phenotypelethal or sterile.
Mutation site280/281-698/699 (418 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(16..534, 1009..1122, 1170..1328))
Map position-0.91
BalancernT1
Map position of balancer
Sequence of primersExtRev:ATATGTCGAAGGCGCTCAAG,IntRev:CCTGCATGCTGAAGGTGATT,IntFwd:ATACTCGACAACGACCGGAA,ExtFwd:AGCGAAGATATCCATTCTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kocsisova Z, Kornfeld K, Schedl T.
Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans.
BMC Dev Biol 2018 18(1) 12 
[ PubMed ID = 29848313 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]