Mutants (Isolated)

tm324

Allele Nametm324
Sequence NameF20C5.2
CGC Nameklp-11
Worm BaseAllele Name tm324
CGC Name klp-11
Sequence F20C5.2
Phenotypehomozygous viable; Dr. M.M. Barr: Dyf+, PKD-2::GFP localization: subtle ciliary mislocalization; Dr. P. Sengupta: 10% of animals fail to dye-fill one AWB neuron when grwon at 25C. Other neurons dye-fill normally. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. C. Bargmann: locomotion OK. Dr. H. Sawa: 0% Psa.
Mutation site15970/15971-16332/16333 (362 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(12579..12756, 12832..13218, 13268..13435, 13540..13599, 13738..13934, 13984..14106, 14390..14524, 14807..14952, 15446..15548, 16119..16234, 16325..16467, 16686..16783,16835..17431, 17474..17795, 17847..17917, 17970..18062, 18106..18355, 18495..18599, 18649..18704, 19251..19295)
Map position3.96
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCTCTGAGCACCGAATTG,IntFwd:TCTCGAGCTGTTTCCACGAG,ExtRev:TCCAAAAGAGCAAGATGAGC,IntRev:GAGCCATCGAAGGATTTTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ou G, Blacque OE, Snow JJ, Leroux MR, Scholey JM.
Functional coordination of intraflagellar transport motors.
Nature 2005 436(7050) 583-7 
[ PubMed ID = 16049494 ] [ RRC reference ]

Qin H, Burnette DT, Bae YK, Forscher P, Barr MM, Rosenbaum JL.
Intraflagellar transport is required for the vectorial movement of TRPV channels in the ciliary membrane.
Curr. Biol. 2005 15(18) 1695-9 
[ PubMed ID = 16169494 ] [ RRC reference ]

Blacque OE, Li C, Inglis PN, Esmail MA, Ou G, Mah AK, Baillie DL, Scholey JM, Leroux MR.
The WD repeat-containing protein IFTA-1 is required for retrograde intraflagellar transport.
Mol. Biol. Cell 2006 17(12) 5053-62 
[ PubMed ID = 17021254 ] [ RRC reference ]

Evans JE, Snow JJ, Gunnarson AL, Ou G, Stahlberg H, McDonald KL, Scholey JM.
Functional modulation of IFT kinesins extends the sensory repertoire of ciliated neurons in Caenorhabditis elegans.
J. Cell Biol. 2006 172(5) 663-9 
[ PubMed ID = 16492809 ] [ RRC reference ]

Pan X, Ou G, Civelekoglu-Scholey G, Blacque OE, Endres NF, Tao L, Mogilner A, Leroux MR, Vale RD, Scholey JM.
Mechanism of transport of IFT particles in C. elegans cilia by the concerted action of kinesin-II and OSM-3 motors.
J. Cell Biol. 2006 174(7) 1035-45 
[ PubMed ID = 17000880 ] [ RRC reference ]

Mukhopadhyay S, Lu Y, Qin H, Lanjuin A, Shaham S, Sengupta P.
Distinct IFT mechanisms contribute to the generation of ciliary structural diversity in C. elegans.
EMBO J. 2007 26(12) 2966-80 
[ PubMed ID = 17510633 ] [ RRC reference ]

Li C, Inglis PN, Leitch CC, Efimenko E, Zaghloul NA, Mok CA, Davis EE, Bialas NJ, Healey MP, Héon E, Zhen M, Swoboda P, Katsanis N, Leroux MR.
An essential role for DYF-11/MIP-T3 in assembling functional intraflagellar transport complexes.
PLoS Genet. 2008 4(3) e1000044 
[ PubMed ID = 18369462 ] [ RRC reference ]

Snow JJ, Ou G, Gunnarson AL, Walker MR, Zhou HM, Brust-Mascher I, Scholey JM.
Two anterograde intraflagellar transport motors cooperate to build sensory cilia on C. elegans neurons.
Nat. Cell Biol. 2004 6(11) 1109-13 
[ PubMed ID = 15489852 ] [ RRC reference ]

Barsi-Rhyne BJ, Miller KM, Vargas CT, Thomas AB, Park J, Bremer M, Jarecki JL, VanHoven MK.
Kinesin-1 acts with netrin and DCC to maintain sensory neuron position in Caenorhabditis elegans.
Genetics 2013 194(1) 175-87 
[ PubMed ID = 23475988 ] [ RRC reference ]

Wang J, Silva M, Haas LA, Morsci NS, Nguyen KC, Hall DH, Barr MM.
C. elegans ciliated sensory neurons release extracellular vesicles that function in animal communication.
Curr. Biol. 2014 24(5) 519-25 
[ PubMed ID = 24530063 ] [ RRC reference ]

Pan X, Acar S, Scholey JM.
Torque generation by one of the motor subunits of heterotrimeric kinesin-2.
Biochem. Biophys. Res. Commun. 2010 401(1) 53-7 
[ PubMed ID = 20833139 ] [ RRC reference ]

Mukhopadhyay S, Lu Y, Shaham S, Sengupta P.
Sensory signaling-dependent remodeling of olfactory cilia architecture in C. elegans.
Dev. Cell 2008 14(5) 762-74 
[ PubMed ID = 18477458 ] [ RRC reference ]

Kaplan OI, Molla-Herman A, Cevik S, Ghossoub R, Kida K, Kimura Y, Jenkins P, Martens JR, Setou M, Benmerah A, Blacque OE.
The AP-1 clathrin adaptor facilitates cilium formation and functions with RAB-8 in C. elegans ciliary membrane transport.
J. Cell. Sci. 2010 123(Pt 22) 3966-77 
[ PubMed ID = 20980383 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]

Kaplan OI, Doroquez DB, Cevik S, Bowie RV, Clarke L, Sanders AA, Kida K, Rappoport JZ, Sengupta P, Blacque OE.
Endocytosis genes facilitate protein and membrane transport in C. elegans sensory cilia.
Curr. Biol. 2012 22(6) 451-60 
[ PubMed ID = 22342749 ] [ RRC reference ]

Bae YK, Qin H, Knobel KM, Hu J, Rosenbaum JL, Barr MM.
General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia.
Development 2006 133(19) 3859-70 
[ PubMed ID = 16943275 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet. 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Hao L, Efimenko E, Swoboda P, Scholey JM.
The retrograde IFT machinery of C. elegans cilia: two IFT dynein complexes?
PLoS ONE 2011 6(6) e20995 
[ PubMed ID = 21695221 ] [ RRC reference ]

Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat. Cell Biol. 2011 13(7) 790-8 
[ PubMed ID = 21642982 ] [ RRC reference ]

O'Hagan R, Silva M, Nguyen KCQ, Zhang W, Bellotti S, Ramadan YH, Hall DH, Barr MM.
Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia.
Curr. Biol. 2017 27(22) 3430-3441.e6 
[ PubMed ID = 29129530 ] [ RRC reference ]