Home > Mutants (Isolated) > tm3236

Mutants (Isolated)

Allele Name		tm3236
Sequence Name		D1009.1a
CGC Name		acs-22
Worm Base	Allele Name	tm3236
	CGC Name	acs-22
	Sequence	D1009.1a
Phenotype		homozygous viable. Dr. S. Mitani: PLoS One, 5 (1), e8857 (2010).
Mutation site		36159/36160-36574/36575 (415 bp deletion)
Chromosome		X
Putative gene structure		join(30386..30390, 33624..33797, 34402..34489, 34620..34727, 35690..35888, 35971..36427, 36472..36635, 37023..37468, 37555..37620, 37675..37771, 37822..37985)
Map position		0.45
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CTTGGGTTCACATCGTACGT,IntFwd:GGTTACAAAATGGGCGACGT,ExtRev:AGCAGTCCTGGAAATACGTC,IntRev:GAGCCGTACAACTCTCCAAT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Li S, Li Q, Kong Y, Wu S, Cui Q, Zhang M, Zhang SO. Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway. Proc Natl Acad Sci U S A 2017 114(33) 8841-8846  [ PubMed ID = 28760992 ] [ RRC reference ] Li S, Xu S, Ma Y, Wu S, Feng Y, Cui Q, Chen L, Zhou S, Kong Y, Zhang X, Yu J, Wu M, Zhang SO. A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans. G3 (Bethesda) 2016 6(8) 2407-19  [ PubMed ID = 27261001 ] [ RRC reference ] Kage-Nakadai E, Kobuna H, Kimura M, Gengyo-Ando K, Inoue T, Arai H, Mitani S. Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans. PLoS One 2010 5(1) e8857  [ PubMed ID = 20111596 ] [ RRC reference ] Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H. Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol. Mol Biol Cell 2010 21(18) 3114-24  [ PubMed ID = 20668164 ] [ RRC reference ]