Mutants (Isolated)

tm3236

Allele Nametm3236
Sequence NameD1009.1a
CGC Nameacs-22
Worm BaseAllele Name tm3236
CGC Name acs-22
Sequence D1009.1a
Phenotypehomozygous viable. Dr. S. Mitani: PLoS One, 5 (1), e8857 (2010).
Mutation site36159/36160-36574/36575 (415 bp deletion)
ChromosomeX
Putative gene structurejoin(30386..30390, 33624..33797, 34402..34489, 34620..34727, 35690..35888, 35971..36427, 36472..36635, 37023..37468, 37555..37620, 37675..37771, 37822..37985)
Map position0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTGGGTTCACATCGTACGT,IntFwd:GGTTACAAAATGGGCGACGT,ExtRev:AGCAGTCCTGGAAATACGTC,IntRev:GAGCCGTACAACTCTCCAAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Li S, Li Q, Kong Y, Wu S, Cui Q, Zhang M, Zhang SO.
Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(33) 8841-8846 
[ PubMed ID = 28760992 ] [ RRC reference ]

Li S, Xu S, Ma Y, Wu S, Feng Y, Cui Q, Chen L, Zhou S, Kong Y, Zhang X, Yu J, Wu M, Zhang SO.
A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(8) 2407-19 
[ PubMed ID = 27261001 ] [ RRC reference ]

Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H.
Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol.
Mol. Biol. Cell 2010 21(18) 3114-24 
[ PubMed ID = 20668164 ] [ RRC reference ]

Kage-Nakadai E, Kobuna H, Kimura M, Gengyo-Ando K, Inoue T, Arai H, Mitani S.
Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.
PLoS ONE 2010 5(1) e8857 
[ PubMed ID = 20111596 ] [ RRC reference ]