Mutants (Isolated)

tm3228

Allele Nametm3228
Sequence NameC25G4.6
CGC NameC25G4.6
Worm BaseAllele Name tm3228
CGC Name C25G4.6
Sequence C25G4.6
Phenotypehomozygous viable.
Mutation site16408/16409-16765/16766 (357 bp deletion)
ChromosomeIV
Putative gene structurejoin(16274..16402, 16450..16713, 16768..17199)
Map position5.99
Balancer
Map position of balancer
Sequence of primersExtRev:CACATCACTTGACCTTGCGA,IntRev:TGCGAAGAGCTTTTCCCTCA,ExtFwd:GCAGAAGCATGGGTTCCGAG,IntFwd:CGAGATCTGTATCGATATGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]