Mutants (Isolated)

tm3224

Allele Nametm3224
Allele TypeNormal
Sequence NameY17G9B.3
Gene Namecyp-31A3
Worm BaseAllele Name tm3224
Gene Name cyp-31A3
Sequence Y17G9B.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12453/12454-12756/12757 (303 bp deletion)
ChromosomeIV
Putative gene structurejoin(11929..12021, 12068..12468, 12512..12608, 12657..13514, 13570..13656)
Map position0.85
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGTTTTGCAATGGGGGTTA,IntFwd:TGTACTTCTCGCTTCGGCGA,ExtRev:CCTCCATGAGTGCAAAACGT,IntRev:GTTACGACTTCCAGCTGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M.
A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia.
Nat Commun 2018 9(1) 5272 
[ PubMed ID = 30532051 ] [ RRC reference ]

Stein KK, Golden A.
The C. elegans eggshell.
WormBook 2018 2018 1-36 
[ PubMed ID = 26715360 ] [ RRC reference ]

Hoang HD, Prasain JK, Dorand D, Miller MA.
A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract.
PLoS Genet 2013 9(1) e1003271 
[ PubMed ID = 23382703 ] [ RRC reference ]

Benenati G, Penkov S, Müller-Reichert T, Entchev EV, Kurzchalia TV.
Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo.
Mech Dev 2009 126(5-6) 382-93 
[ PubMed ID = 19368796 ] [ RRC reference ]