Home > Mutants (Isolated) > tm3224

Mutants (Isolated)

Allele Name		tm3224
Sequence Name		Y17G9B.3
CGC Name		cyp-31A3
Worm Base	Allele Name	tm3224
	CGC Name	cyp-31A3
	Sequence	Y17G9B.3
Phenotype		homozygous viable.
Mutation site		12453/12454-12756/12757 (303 bp deletion)
Chromosome		IV
Putative gene structure		join(11929..12021, 12068..12468, 12512..12608, 12657..13514, 13570..13656)
Map position		0.85
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AGGTTTTGCAATGGGGGTTA,IntFwd:TGTACTTCTCGCTTCGGCGA,ExtRev:CCTCCATGAGTGCAAAACGT,IntRev:GTTACGACTTCCAGCTGAGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M. A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia. Nat Commun 2018 9(1) 5272  [ PubMed ID = 30532051 ] [ RRC reference ] Stein KK, Golden A. The C. elegans eggshell. WormBook 2018 2018 1-36  [ PubMed ID = 26715360 ] [ RRC reference ] Hoang HD, Prasain JK, Dorand D, Miller MA. A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract. PLoS Genet 2013 9(1) e1003271  [ PubMed ID = 23382703 ] [ RRC reference ] Benenati G, Penkov S, Müller-Reichert T, Entchev EV, Kurzchalia TV. Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo. Mech Dev 2009 126(5-6) 382-93  [ PubMed ID = 19368796 ] [ RRC reference ]