Mutants (Isolated)

tm3223

Allele Nametm3223
Sequence NameK02G10.8
CGC Namednj-14
Worm BaseAllele Name tm3223
CGC Name dnj-14
Sequence K02G10.8
Phenotypehomozygous viable.
Mutation site37035/37036-AAA-37266/37267 (231 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(36850..36856, 36911..37384, 38166..38332))
Map position-6.84
Balancer
Map position of balancer
Sequence of primersIntRev:CAGAGCGTATCGCAAACTAG,ExtRev:GTTCAGGGAGAGACCAATAG,ExtFwd:GCTCTCAACAGACCCATACT,IntFwd:GGAGGCATGGCAATCACAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kashyap SS, Johnson JR, McCue HV, Chen X, Edmonds MJ, Ayala M, Graham ME, Jenn RC, Barclay JW, Burgoyne RD, Morgan A.
Caenorhabditis elegans dnj-14, the orthologue of the DNAJC5 gene mutated in adult onset neuronal ceroid lipofuscinosis, provides a new platform for neuroprotective drug screening and identifies a SIR-2.1-independent action of resveratrol.
Hum. Mol. Genet. 2014 23(22) 5916-27 
[ PubMed ID = 24947438 ] [ RRC reference ]

Chen X, McCue HV, Wong SQ, Kashyap SS, Kraemer BC, Barclay JW, Burgoyne RD, Morgan A.
Ethosuximide ameliorates neurodegenerative disease phenotypes by modulating DAF-16/FOXO target gene expression.
Mol Neurodegener 2015 10 51 
[ PubMed ID = 26419537 ] [ RRC reference ]

McCue HV, Chen X, Barclay JW, Morgan A, Burgoyne RD.
Expression profile of a Caenorhabditis elegans model of adult neuronal ceroid lipofuscinosis reveals down regulation of ubiquitin E3 ligase components.
Sci Rep 2015 5 14392 
[ PubMed ID = 26395859 ] [ RRC reference ]