Mutants (Isolated)

tm321

Allele Nametm321
Sequence NameF22D3.1a
CGC Nameceh-38
Worm BaseAllele Name tm321
CGC Name ceh-38
Sequence F22D3.1a
Phenotypehomozygous viable. Dr. D. Portman: male tail normal. Dr. O. Hobert: normal ASE development. Dr. WB Derry: normal germline apoptosis.
Mutation site27464/27465-27984/27985 (520 bp deletion)
ChromosomeII
Putative gene structurejoin (27077..27114, 27160..27471, 27520..27622, 27751..28066, 28189..28675, 28796..29036, 29170..29256, 29386..29736)
Map position0.16
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCCTGTGGCCATCAGTAT,IntFwd:TCGCAACTAGTATGTTCTCCCA,ExtRev:CAGAATGACTAGGACCCGGA,IntRev:ACATTTCCGCCATCTGAAAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Staal J, Driege Y, Haegman M, Borghi A, Hulpiau P, Lievens L, Gul IS, Sundararaman S, Gonçalves A, Dhondt I, Pinzón JH, Braeckman BP, Technau U, Saeys Y, van Roy F, Beyaert R.
Ancient Origin of the CARD-Coiled Coil/Bcl10/MALT1-Like Paracaspase Signaling Complex Indicates Unknown Critical Functions.
Front Immunol 2018 9 1136 
[ PubMed ID = 29881386 ] [ RRC reference ]

Smith CJ, Watson JD, Spencer WC, O'Brien T, Cha B, Albeg A, Treinin M, Miller DM 3rd.
Time-lapse imaging and cell-specific expression profiling reveal dynamic branching and molecular determinants of a multi-dendritic nociceptor in C. elegans.
Dev Biol 2010 345(1) 18-33 
[ PubMed ID = 20537990 ] [ RRC reference ]

Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]