Mutants (Isolated)

tm3203

Allele Nametm3203
Sequence NameT20G5.5
CGC Nameepac-1
Worm BaseAllele Name tm3203
CGC Name epac-1
Sequence T20G5.5
Phenotypehomozygous viable.
Mutation site19876/19877-20571/20572 (695 bp deletion)
ChromosomeIII
Putative gene structurejoin(16308..16895, 17823..17946, 17992..18068, 18328..18474, 18744..19139, 19645..19869, 19927..20018, 20065..20421, 20475..20692, 21185..21288, 21345..22231, 22281..22371, 23025..23228, 23540..23647, 23695..23781)
Map position1.98
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGTGCTGAAATGATTGACT,IntRev:TGATCTATGGGGCGCAATAC,IntFwd:AGCGCAATTTGGCAAGTCCT,ExtRev:GTACGGCCGTGTGGAGAATT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Tada M, Gengyo-Ando K, Kobayashi T, Fukuyama M, Mitani S, Kontani K, Katada T.
Neuronally expressed Ras-family GTPase Di-Ras modulates synaptic activity in Caenorhabditis elegans.
Genes Cells 2012 17(9) 778-89 
[ PubMed ID = 22897658 ] [ RRC reference ]