Mutants (Isolated)

tm3199

Allele Nametm3199
Sequence NameR02E12.6
CGC NameR02E12.6
Worm BaseAllele Name tm3199
CGC Name R02E12.6
Sequence R02E12.6
Phenotypehomozygous viable.
Mutation site22153/22154-22494/22495 (341 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(21708..21955, 22060..22299, 22349..22445))
Map position-8.73
Balancer
Map position of balancer
Sequence of primersExtRev:AGTCGAGCCATATGGTGCAA,IntFwd:TAGTCACAGAGTACTCTGGT,IntRev:TAAATATGGGGGCAGTAGTG,ExtFwd:GGCACAAGGTCCAATAGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yuan X, Protchenko O, Philpott CC, Hamza I.
Topologically conserved residues direct heme transport in HRG-1-related proteins.
J. Biol. Chem. 2012 287(7) 4914-24 
[ PubMed ID = 22174408 ] [ RRC reference ]