Mutants (Isolated)

tm3197

Allele Nametm3197
Sequence NameC29F7.6
CGC Namejmjd-3.3
Worm BaseAllele Name tm3197
CGC Name jmjd-3.3
Sequence C29F7.6
Phenotypehomozygous viable. Dr. R.H. Horvitz: pharyngeal morphology normal. Dr. Hongkyun Kim: normal locomotion. Dr. M. Han: normal vulval phenotype.
Mutation site30405/30406-30657/30658 (252 bp deletion)
ChromosomeX
Putative gene structurejoin(28617..28785, 28994..29226, 30312..31107, 31484..31686, 32136..32719, 32961..33170, 33217..33572)
Map position12.4
Balancer
Map position of balancer
Sequence of primersExtFwd:CTAATCGTCCTGACTACATG,ExtRev:GAGACTTTGACGCACGTATG,IntFwd:CTTACTTCTGGAGTACGGCA,IntRev:CCAAACTACCCTTACTCGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A.
H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner.
BMC Biol 2021 19(1) 59 
[ PubMed ID = 33766022 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristiz√°bal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colai√°covo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]

McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]