Mutants (Isolated)

tm3188

Allele Nametm3188
Sequence NameK08E7.1
CGC Nameeak-7
Worm BaseAllele Name tm3188
CGC Name eak-7
Sequence K08E7.1
Phenotypehomozygous viable.
Mutation site4705/4706-5222/5223 (517 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(3087..3284, 3345..3467, 3549..3694, 4139..4565, 4613..4792, 4848..4973))
Map position6.02
Balancer
Map position of balancer
Sequence of primersIntFwd:TGTGTACCTTGCGAGGCGAA,ExtRev:GCACGTGTTGAGAGGATTCA,IntRev:ACTATGTTGTGCCTCCTGCT,ExtFwd:TAACACAGCCATGTGTGGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Dumas KJ, Delaney CE, Flibotte S, Moerman DG, Csankovszki G, Hu PJ.
Unexpected role for dosage compensation in the control of dauer arrest, insulin-like signaling, and FoxO transcription factor activity in Caenorhabditis elegans.
Genetics 2013 194(3) 619-29 
[ PubMed ID = 23733789 ] [ RRC reference ]

Ferguson AA, Roy S, Kormanik KN, Kim Y, Dumas KJ, Ritov VB, Matern D, Hu PJ, Fisher AL.
TATN-1 mutations reveal a novel role for tyrosine as a metabolic signal that influences developmental decisions and longevity in Caenorhabditis elegans.
PLoS Genet. 2013 9(12) e1004020 
[ PubMed ID = 24385923 ] [ RRC reference ]

Itani OA, Flibotte S, Dumas KJ, Guo C, Blumenthal T, Hu PJ.
N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Reveals an Intronic Residue Critical for Caenorhabditis elegans 3' Splice Site Function in Vivo.
G3 (Bethesda) 2016 6(6) 1751-6 
[ PubMed ID = 27172199 ] [ RRC reference ]

Alam H, Williams TW, Dumas KJ, Guo C, Yoshina S, Mitani S, Hu PJ.
EAK-7 controls development and life span by regulating nuclear DAF-16/FoxO activity.
Cell Metab. 2010 12(1) 30-41 
[ PubMed ID = 20620993 ] [ RRC reference ]

Delaney CE, Chen AT, Graniel JV, Dumas KJ, Hu PJ.
A histone H4 lysine 20 methyltransferase couples environmental cues to sensory neuron control of developmental plasticity.
Development 2017 144(7) 1273-1282 
[ PubMed ID = 28209779 ] [ RRC reference ]