Mutants (Isolated)

tm3174

Allele Nametm3174
Sequence NameF55D10.5
CGC Nameacc-3
Worm BaseAllele Name tm3174
CGC Name acc-3
Sequence F55D10.5
Phenotypehomozygous viable.
Mutation site12466/12467-12749/12750 (283 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(10731..10838, 10888..11054, 11942..12208, 12254..12390, 12439..12551, 12638..12745, 12794..13024, 13077..13220, 13869..13991, 14039..14092, 14470..14571))
Map position-6.75
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTGGGCTGTTTGGGCACGA,IntFwd:TGTACTATTCTCCCGACCTT,ExtRev:CGACCAAATCTGGAAGCCTA,IntRev:GTATGGGTGAACTATAGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takayanagi-Kiya S, Zhou K, Jin Y.
Release-dependent feedback inhibition by a presynaptically localized ligand-gated anion channel.
Elife 2016 5  
[ PubMed ID = 27782882 ] [ RRC reference ]