Mutants (Isolated)

tm3163

Allele Nametm3163
Sequence NameY55F3AM.12
CGC Namedcap-1
Worm BaseAllele Name tm3163
CGC Name dcap-1
Sequence Y55F3AM.12
Phenotypehomozygous viable. Dr. H. Zhang: normal locomotion, Gro and small brood size at 25 C.
Mutation site74149/74150-74483/74484 (334 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(73580..73684, 74389..75073, 75140..75249, 75299..75397))
Map position-22.41
Balancer
Map position of balancer
Sequence of primersIntRev:AGCTAGCCGCGAAAAACCTC,ExtRev:ACCAGTATGAGCGACGCTAA,IntFwd:TACCTAAGCTAGACTAAGCC,ExtFwd:TAGGTGGGCGATTGCTGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Adachi T, Nagahama K, Izumi S.
The C. elegans mRNA decapping enzyme shapes morphology of cilia.
Biochem. Biophys. Res. Commun. 2017 493(1) 382-387 
[ PubMed ID = 28887031 ] [ RRC reference ]

Borbolis F, Flessa CM, Roumelioti F, Diallinas G, Stravopodis DJ, Syntichaki P.
Neuronal function of the mRNA decapping complex determines survival of Caenorhabditis elegans at high temperature through temporal regulation of heterochronic gene expression.
Open Biol 2017 7(3)  
[ PubMed ID = 28250105 ] [ RRC reference ]

Sun Y, Yang P, Zhang Y, Bao X, Li J, Hou W, Yao X, Han J, Zhang H.
A genome-wide RNAi screen identifies genes regulating the formation of P bodies in C. elegans and their functions in NMD and RNAi.
Protein Cell 2011 2(11) 918-39 
[ PubMed ID = 22180091 ] [ RRC reference ]

Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P.
Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans.
PLoS ONE 2014 9(7) e103365 
[ PubMed ID = 25061667 ] [ RRC reference ]