Home > Mutants (Isolated) > tm3146

Mutants (Isolated)

Allele Name		tm3146
Allele Type		Balanced
Sequence Name		F25H8.3
Gene Name		gon-1
Worm Base	Allele Name	tm3146
	Gene Name	gon-1
	Sequence	F25H8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[T13H10] 4793/4794-CACATGACCCAATTCAT-[T13H10] 5227/5228 (434 bp deletion + 17 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(28250..29281, 29330..29526, 29624..29760, 29809..29989, 30036..30387, 30434..30607, 31081..31254, 31314..31484, 179..460, 505..663, 715..1200, 1247..1507, 1565..2435, 2487..2928, 3026..3235, 3286..3614, 4003..4151, 4207..4317, 4368..4524, 4574..4668, 4714..5261, 6292..6441, 6486..6552, 6596..6770, 6821..7070, 7118..7180, 7244..7600, 7933..8053, 10883..10951, 14945..14992))
Map position		4.45
Balancer		nT1,nT1 [qIs51]
Map position of balancer
Sequence of primers		ExtFwd:TCCGTCGGCCCATGGCATAT,IntFwd:AGCCCATCTGGCTTCCGTAG,ExtRev:GGGTGTTGTGTAATAGCCCA,IntRev:GTGGGTCCCCTATAGCTAAT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023    [ PubMed ID = 38045350 ] [ RRC reference ] Yoshina S, Sakaki K, Yonezumi-Hayashi A, Gengyo-Ando K, Inoue H, Iino Y, Mitani S. Identification of a novel ADAMTS9/GON-1 function for protein transport from the ER to the Golgi. Mol Biol Cell 2012 23(9) 1728-41  [ PubMed ID = 22419820 ] [ RRC reference ] Yoshina S, Mitani S. Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation. PLoS One 2015 10(7) e0133966  [ PubMed ID = 26218657 ] [ RRC reference ]