Mutants (Isolated)

tm3146

Allele Nametm3146
Sequence NameF25H8.3
CGC Namegon-1
Worm BaseAllele Name tm3146
CGC Name gon-1
Sequence F25H8.3
Phenotypelethal or sterile.
Mutation site[T13H10] 4793/4794-CACATGACCCAATTCAT-[T13H10] 5227/5228 (434 bp deletion + 17 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(29111..29281, 29330..29526, 29624..29760, 29809..29989, 30036..30387, 30434..30607, 31081..31254, 31314..31484, Z69361.1:179..460, Z69361.1:505..663, Z69361.1:715..1200, Z69361.1:1247..1507, Z69361.1:1565..2435, Z69361.1:2487..2928, Z69361.1:3026..3235, Z69361.1:3286..3614, Z69361.1:4003..4151, Z69361.1:4207..4317, Z69361.1:4368..4524, Z69361.1:4574..5261, Z69361.1:6292..6441, Z69361.1:6486..6552, Z69361.1:6596..6770, Z69361.1:6821..7070, Z69361.1:7118..7180, Z69361.1:7244..7334))
Map position4.45
BalancernT1
Map position of balancer
Sequence of primersExtFwd:TCCGTCGGCCCATGGCATAT,IntFwd:AGCCCATCTGGCTTCCGTAG,ExtRev:GGGTGTTGTGTAATAGCCCA,IntRev:GTGGGTCCCCTATAGCTAAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yoshina S, Sakaki K, Yonezumi-Hayashi A, Gengyo-Ando K, Inoue H, Iino Y, Mitani S.
Identification of a novel ADAMTS9/GON-1 function for protein transport from the ER to the Golgi.
Mol. Biol. Cell 2012 23(9) 1728-41 
[ PubMed ID = 22419820 ] [ RRC reference ]

Yoshina S, Mitani S.
Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation.
PLoS ONE 2015 10(7) e0133966 
[ PubMed ID = 26218657 ] [ RRC reference ]