Mutants (Isolated)

tm3144

Allele Nametm3144
Sequence NameW03B1.4
CGC Namesrs-1
Worm BaseAllele Name tm3144
CGC Name srs-1
Sequence W03B1.4
Phenotypehomozgyous viable.
Mutation site36855/36856-37053/37054 (198 bp deletion)
ChromosomeIV
Putative gene structurejoin(35892..36082, 36157..36464, 36915..37392, 37726..37975, 38028..38126)
Map position0.17
Balancer
Map position of balancer
Sequence of primersExtRev:TTGCCCTGCTAATGTCAAAC,IntRev:CCTGCTAATGTCAAACACGT,IntFwd:TACTACATCAGAGATCGGGA,ExtFwd:GGCATAGTTAGGAGCAGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]