Home > Mutants (Isolated) > tm3138

Mutants (Isolated)

Allele Name		tm3138
Allele Type		Normal
Sequence Name		C46H11.11
Gene Name		fhod-1
Worm Base	Allele Name	tm3138
	Gene Name	fhod-1
	Sequence	C46H11.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		43758/43759-AC-44273/44274 (515 bp deletion + 2 bp insertion)
Chromosome		I
Putative gene structure		complement(join(38868..38923, 39048..39167, 39213..39677, 39729..40434, 40486..40775, 41022..41358, 41405..41533, 41616..41742, 41858..41945, 43617..43851, 44442..44642, 44856..44923, 45478..45536, 48449..48623, 48944..49076))
Map position		-0.42
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACTGCGTCGTAGTACGTGTC,IntFwd:ACTCTGTCTGGAATCCCATG,ExtRev:ATACGCCAGGCACGTCTTTA,IntRev:GTTACCGGTGCAAACATGCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hegsted A, Wright FA, Votra S, Pruyne D. INF2- and FHOD-related formins promote ovulation in the somatic gonad of C. elegans. Cytoskeleton (Hoboken) 2016 73(12) 712-728  [ PubMed ID = 27770600 ] [ RRC reference ] Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D. Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans. J Cell Biol 2012 198(1) 87-102  [ PubMed ID = 22753896 ] [ RRC reference ]