Mutants (Isolated)

tm3136

Allele Nametm3136
Sequence NameD2021.1
CGC NameD2021.1
Worm BaseAllele Name tm3136
CGC Name D2021.1
Sequence D2021.1
Phenotypelethal or sterile. Dr. R.H. Horvitz, Dr. A. Salcini: Mel, homozygous mothers lay lethal progeny (embryonic or L1). Dr. H. Sawa: 0% extra DTC. Dr. M. Han: early larval lethal.
Mutation site13919/13920-14155/14156 (236 bp deletion)
ChromosomeX
Putative gene structurejoin(13888..13923, 13976..14052, 14106..14432, 14482..14602, 14935..15075, 15130..15402, 15519..15638, 15783..15915, 16607..16791, 16839..17159, 17492..18364, 18420..19009, 19058..19246, 19431..19551)
Map position0.12
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:CTCCGTTTCTAACGTTGATC,IntFwd:TGCATGAACACCGTATCGCT,ExtRev:GACTCATCACTGTCGTTGAC,IntRev:CATGCGTATTCTCGGTCTTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Vandamme J, Lettier G, Sidoli S, Di Schiavi E, Nørregaard Jensen O, Salcini AE.
The C. elegans H3K27 demethylase UTX-1 is essential for normal development, independent of its enzymatic activity.
PLoS Genet. 2012 8(5) e1002647 
[ PubMed ID = 22570628 ] [ RRC reference ]