Mutants (Isolated)

tm3124

Allele Nametm3124
Sequence NameY55D9A.1
CGC Nameefa-6
Worm BaseAllele Name tm3124
CGC Name efa-6
Sequence Y55D9A.1
Phenotypehomozygous viable. Dr. O. Blacque: dye-filling normal.
Mutation site10863/10864-11434/11435 (571 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(6732..6917, 7587..8092, 10496..11028, 11082..11265, 11384..11618, 11923..12044, 12428..12580, 14018..14257, 14678..14825, 15198..15347))
Map position6.09
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCTTTCCACCATCAGTCTC,ExtRev:GGACACTCCGTCGAAACATT,IntFwd:GTTGTGGCTGCCGTCTTGAT,IntRev:CCGTCGAAACATTCAGTGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Xu A, Zhang Z, Ko SH, Fisher AL, Liu Z, Chen L.
Microtubule regulators act in the nervous system to modulate fat metabolism and longevity through DAF-16 in C. elegans.
Aging Cell 2019 18(2) e12884 
[ PubMed ID = 30638295 ] [ RRC reference ]

Chen L, Chuang M, Koorman T, Boxem M, Jin Y, Chisholm AD.
Axon injury triggers EFA-6 mediated destabilization of axonal microtubules via TACC and doublecortin like kinase.
Elife 2015 4  
[ PubMed ID = 26339988 ] [ RRC reference ]

Chen L, Wang Z, Ghosh-Roy A, Hubert T, Yan D, O'Rourke S, Bowerman B, Wu Z, Jin Y, Chisholm AD.
Axon regeneration pathways identified by systematic genetic screening in C. elegans.
Neuron 2011 71(6) 1043-57 
[ PubMed ID = 21943602 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J Cell Biol 2019 218(1) 125-133 
[ PubMed ID = 30396999 ] [ RRC reference ]

O'Rourke SM, Christensen SN, Bowerman B.
Caenorhabditis elegans EFA-6 limits microtubule growth at the cell cortex.
Nat Cell Biol 2010 12(12) 1235-41 
[ PubMed ID = 21076413 ] [ RRC reference ]

Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G.
Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans.
Genetics 2014 198(1) 229-47 
[ PubMed ID = 25053664 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460 
[ PubMed ID = 27764672 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]