Mutants (Isolated)

tm3122

Allele Nametm3122
Sequence NameK07A1.11
CGC Namerba-1
Worm BaseAllele Name tm3122
CGC Name rba-1
Sequence K07A1.11
Phenotypelethal or sterile
Mutation site36699/36700-37041/37042 (342 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(36022..36081, 36132..36318, 36377..36631, 36692..36843, 36886..37326, 37374..37517))
Map position3.81
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntRev:TCTCTACGATACAGTCGTCA,ExtRev:CCGATGTGGTAGAGAGACAA,IntFwd:AGTCCATGGGCGGTTGGGAT,ExtFwd:GCATTAAATTCGTCGCTGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Oosterveen T, Coudreuse DY, Yang PT, Fraser E, Bergsma J, Dale TC, Korswagen HC.
Two functionally distinct Axin-like proteins regulate canonical Wnt signaling in C. elegans.
Dev. Biol. 2007 308(2) 438-48 
[ PubMed ID = 17601533 ] [ RRC reference ]