Mutants (Isolated)

tm3118

Allele Nametm3118
Allele TypeNormal
Sequence NameD2021.1
Gene NameD2021.1
Worm BaseAllele Name tm3118
Gene Name D2021.1
Sequence D2021.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. R.H. Horvitz, Dr. A. Salcini: Mel, homozygous mothers lay lethal progeny (embryonic or L1).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17360/17361-17907/17908 (547 bp deletion)
ChromosomeX
Putative gene structurejoin(13888..13923, 13976..14052, 14106..14432, 14482..14602, 14935..15075, 15130..15402, 15519..15638, 15783..15915, 16607..16791, 16839..17159, 17492..18364, 18420..19009, 19058..19246, 19431..19551)
Map position0.12
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCGCCAGTGTTGCTTCTAA,IntFwd:GAGTAGACGCAATGAGCCTA,ExtRev:ATCGGCAACCATTCTCAGGA,IntRev:CTTAGGCTACTCACCTAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050 
[ PubMed ID = 34818537 ] [ RRC reference ]

Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A.
H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner.
BMC Biol 2021 19(1) 59 
[ PubMed ID = 33766022 ] [ RRC reference ]

Maures TJ, Greer EL, Hauswirth AG, Brunet A.
The H3K27 demethylase UTX-1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner.
Aging Cell 2011 10(6) 980-90 
[ PubMed ID = 21834846 ] [ RRC reference ]

Jin C, Li J, Green CD, Yu X, Tang X, Han D, Xian B, Wang D, Huang X, Cao X, Yan Z, Hou L, Liu J, Shukeir N, Khaitovich P, Chen CD, Zhang H, Jenuwein T, Han JD.
Histone demethylase UTX-1 regulates C. elegans life span by targeting the insulin/IGF-1 signaling pathway.
Cell Metab 2011 14(2) 161-72 
[ PubMed ID = 21803287 ] [ RRC reference ]