Mutants (Isolated)

tm3116

Allele Nametm3116
Allele TypeBalanced
Sequence NameC05D11.7
Gene Nameatgl-1
Worm BaseAllele Name tm3116
Gene Name atgl-1
Sequence C05D11.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15425/15426-15848/15849 (423 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(13010..13720, 13899..14484, 14685..14798, 14853..14985, 15034..15137, 15186..15351, 15432..15862, 16357..16688, 18786..19116))
Map position-1.27
BalancerhT2 bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntRev:TCTGCTAGCTAGCAATACCA,IntFwd:CCTCGAGTGGAATATCACTG,ExtFwd:GTGGTAGCATATCGAACGAG,ExtRev:AGCCACAGAATGACGTCTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mudd N, Liceaga AM.
Caenorhabditis elegans as an in vivo model for food bioactives: A review.
Curr Res Food Sci 2022 5 845-856 
[ PubMed ID = 35619588 ] [ RRC reference ]

Zaarur N, Desevin K, Mackenzie J, Lord A, Grishok A, Kandror KV.
ATGL-1 mediates the effect of dietary restriction and the insulin/IGF-1 signaling pathway on longevity in C. elegans.
Mol Metab 2019 27 75-82 
[ PubMed ID = 31311719 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration.
Elife 2018 7  
[ PubMed ID = 30461420 ] [ RRC reference ]

Tao J, Ma YC, Yang ZS, Zou CG, Zhang KQ.
Octopamine connects nutrient cues to lipid metabolism upon nutrient deprivation.
Sci Adv 2016 2(5) e1501372 
[ PubMed ID = 27386520 ] [ RRC reference ]