Mutants (Isolated)

tm3103

Allele Nametm3103
Sequence NameW08G11.4
CGC Namepptr-1
Worm BaseAllele Name tm3103
CGC Name pptr-1
Sequence W08G11.4
PhenotypeGro. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium.
Mutation site13958/13959-14165/14166 (207 bp deletion)
ChromosomeV
Putative gene structurejoin(14111..14271, 14322..14392, 15297..15595, 16565..16788, 17686..17854, 18173..18274, 19432..19626, 20510..20800, 22228..22344)
Map position9.99
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTTTACACCATTCCGCGTT,IntFwd:CCGCGTTAATAAAAACCCTC,ExtRev:TACGAATTTGCAGCGACCGA,IntRev:AATCTGCGGCAGGGTGGCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Qadota H, Matsunaga Y, Bagchi P, Lange KI, Carrier KJ, Pols WV, Swartzbaugh E, Wilson KJ, Srayko M, Pallas DC, Benian GM.
Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle.
Mol Biol Cell 2018 29(17) 2084-2097 
[ PubMed ID = 29949401 ] [ RRC reference ]

Gallo CM, Wang JT, Motegi F, Seydoux G.
Cytoplasmic partitioning of P granule components is not required to specify the germline in C. elegans.
Science 2010 330(6011) 1685-9 
[ PubMed ID = 21127218 ] [ RRC reference ]

Lev I, Toker IA, Mor Y, Nitzan A, Weintraub G, Antonova O, Bhonkar O, Ben Shushan I, Seroussi U, Claycomb JM, Anava S, Gingold H, Zaidel-Bar R, Rechavi O.
Germ Granules Govern Small RNA Inheritance.
Curr Biol 2019 29(17) 2880-2891.e4 
[ PubMed ID = 31378614 ] [ RRC reference ]

Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M.
In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics.
Mol Cell Proteomics 2016 15(5) 1642-57 
[ PubMed ID = 26912668 ] [ RRC reference ]