Home > Mutants (Isolated) > tm3103

Mutants (Isolated)

Allele Name		tm3103
Allele Type		Normal
Sequence Name		W08G11.4
Gene Name		pptr-1
Worm Base	Allele Name	tm3103
	Gene Name	pptr-1
	Sequence	W08G11.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Gro. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13958/13959-14165/14166 (207 bp deletion)
Chromosome		V
Putative gene structure		join(14111..14271, 14322..14392, 15297..15595, 16565..16788, 17686..17854, 18173..18274, 19432..19626, 20510..20800, 22228..22344)
Map position		9.99
Balancer
Map position of balancer
Sequence of primers		IntFwd:CCGCGTTAATAAAAACCCTC,ExtRev:TACGAATTTGCAGCGACCGA,IntRev:AATCTGCGGCAGGGTGGCAA,ExtFwd:CTTTTACACCATTCCGCGTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Rieger I, Weintraub G, Lev I, Goldstein K, Bar-Zvi D, Anava S, Gingold H, Shaham S, Rechavi O. Nucleus-independent transgenerational small RNA inheritance in Caenorhabditis elegans. Sci Adv 2023 9(43) eadj8618  [ PubMed ID = 37878696 ] [ RRC reference ] Lev I, Toker IA, Mor Y, Nitzan A, Weintraub G, Antonova O, Bhonkar O, Ben Shushan I, Seroussi U, Claycomb JM, Anava S, Gingold H, Zaidel-Bar R, Rechavi O. Germ Granules Govern Small RNA Inheritance. Curr Biol 2019 29(17) 2880-2891.e4  [ PubMed ID = 31378614 ] [ RRC reference ] Qadota H, Matsunaga Y, Bagchi P, Lange KI, Carrier KJ, Pols WV, Swartzbaugh E, Wilson KJ, Srayko M, Pallas DC, Benian GM. Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle. Mol Biol Cell 2018 29(17) 2084-2097  [ PubMed ID = 29949401 ] [ RRC reference ] Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M. In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics. Mol Cell Proteomics 2016 15(5) 1642-57  [ PubMed ID = 26912668 ] [ RRC reference ] Gallo CM, Wang JT, Motegi F, Seydoux G. Cytoplasmic partitioning of P granule components is not required to specify the germline in C. elegans. Science 2010 330(6011) 1685-9  [ PubMed ID = 21127218 ] [ RRC reference ]