Mutants (Isolated)

tm310

Allele Nametm310
Sequence NameZC123.3
CGC NameZC123.3
Worm BaseAllele Name tm310
CGC Name ZC123.3
Sequence ZC123.3
Phenotypelethal or sterile
Mutation site24419/24420-26008/26009 (1589 bp deletion)
ChromosomeI
Putative gene structurejoin(4..76, 947..1024, 1072..1497, 2202..2482, 15847..16024, 16866..17046, 18063..18130, 19695..19872, 20802..20907, 21212..21364, 24232..24444, 24627..25327, 26414..26528, 27711..28324, 28379..29422, 29492..29735, 29785..29874, 31142..31270)
Map position-21.5
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:TTGAAGTAAAGCAGTGGTGG,IntFwd:GTGCTTAGCTCGACCTATAT,IntRev:AGCTTTCCCGAAGCTCGAAT,ExtRev:ACCCATCCTTTAAGCTTTCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Rose S, Malabarba MG, Krag C, Schultz A, Tsushima H, Di Fiore PP, Salcini AE.
Caenorhabditis elegans intersectin: a synaptic protein regulating neurotransmission.
Mol. Biol. Cell 2007 18(12) 5091-9 
[ PubMed ID = 17942601 ] [ RRC reference ]