Mutants (Isolated)

tm3098

Allele Nametm3098
Allele TypeNormal
Sequence NameR08D7.6
Gene Namepde-2
Worm BaseAllele Name tm3098
Gene Name pde-2
Sequence R08D7.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14789/14790-15072/15073 (283 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(9796..9996, 10048..10269, 10545..10782, 11328..12220, 12277..12360, 12929..13038, 14074..14315, 14539..14783, 15062..15261, 15404..15469, 15809..16036, 16719..16746))
Map position0.06
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGGACATCTGCTCACATCG,IntFwd:GCGAATGTTCATCGTTCGCA,ExtRev:ACGAAGCAGCTAGCGGGTCA,IntRev:GCGGAGGCATGACTGGTAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684 
[ PubMed ID = 35727855 ] [ RRC reference ]

Park J, Meisel JD, Kim DH.
Immediate activation of chemosensory neuron gene expression by bacterial metabolites is selectively induced by distinct cyclic GMP-dependent pathways in Caenorhabditis elegans.
PLoS Genet 2020 16(8) e1008505 
[ PubMed ID = 32776934 ] [ RRC reference ]

Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell 2016 165(4) 936-48 
[ PubMed ID = 27062922 ] [ RRC reference ]

Ujisawa T, Ohta A, Uda-Yagi M, Kuhara A.
Diverse Regulation of Temperature Sensation by Trimeric G-Protein Signaling in Caenorhabditis elegans.
PLoS One 2016 11(10) e0165518 
[ PubMed ID = 27788246 ] [ RRC reference ]

Liu J, Ward A, Gao J, Dong Y, Nishio N, Inada H, Kang L, Yu Y, Ma D, Xu T, Mori I, Xie Z, Xu XZ.
C. elegans phototransduction requires a G protein-dependent cGMP pathway and a taste receptor homolog.
Nat Neurosci 2010 13(6) 715-22 
[ PubMed ID = 20436480 ] [ RRC reference ]

Wang D, O'Halloran D, Goodman MB.
GCY-8, PDE-2, and NCS-1 are critical elements of the cGMP-dependent thermotransduction cascade in the AFD neurons responsible for C. elegans thermotaxis.
J Gen Physiol 2013 142(4) 437-49 
[ PubMed ID = 24081984 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr Biol 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]

Cao P, Sun W, Kramp K, Zheng M, Salom D, Jastrzebska B, Jin H, Palczewski K, Feng Z.
Light-sensitive coupling of rhodopsin and melanopsin to G(i/o) and G(q) signal transduction in Caenorhabditis elegans.
FASEB J 2012 26(2) 480-91 
[ PubMed ID = 22090313 ] [ RRC reference ]

Couto A, Oda S, Nikolaev VO, Soltesz Z, de Bono M.
In vivo genetic dissection of O2-evoked cGMP dynamics in a Caenorhabditis elegans gas sensor.
Proc Natl Acad Sci U S A 2013 110(35) E3301-10 
[ PubMed ID = 23940325 ] [ RRC reference ]

Beckert U, Aw WY, Burhenne H, Försterling L, Kaever V, Timmons L, Seifert R.
The Receptor-Bound Guanylyl Cyclase DAF-11 Is the Mediator of Hydrogen Peroxide-Induced cGMP Increase in Caenorhabditis elegans [corrected].
PLoS One 2013 8(8) e72569 
[ PubMed ID = 24015261 ] [ RRC reference ]

Bhatla N, Horvitz HR.
Light and hydrogen peroxide inhibit C. elegans Feeding through gustatory receptor orthologs and pharyngeal neurons.
Neuron 2015 85(4) 804-18 
[ PubMed ID = 25640076 ] [ RRC reference ]