Mutants (Isolated)

tm3098

Allele Name

tm3098

Allele Type

Normal

Sequence Name

R08D7.6

Gene Name

pde-2

Worm Base

Allele Name

tm3098

Gene Name

pde-2

Sequence

R08D7.6

Phenotype

homozygous viable.

Mutation site

14789/14790-15072/15073 (283 bp deletion)

Chromosome

III

Putative gene structure

complement(join(9796..9996, 10048..10269, 10545..10782, 11328..12220, 12277..12360, 12929..13038, 14074..14315, 14539..14783, 15062..15261, 15404..15469, 15809..16036, 16719..16746))

Map position

0.06

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACGGACATCTGCTCACATCG,IntFwd:GCGAATGTTCATCGTTCGCA,ExtRev:ACGAAGCAGCTAGCGGGTCA,IntRev:GCGGAGGCATGACTGGTAAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684
[ PubMed ID = 35727855 ] [ RRC reference ]

Park J, Meisel JD, Kim DH.
Immediate activation of chemosensory neuron gene expression by bacterial metabolites is selectively induced by distinct cyclic GMP-dependent pathways in Caenorhabditis elegans.
PLoS Genet 2020 16(8) e1008505
[ PubMed ID = 32776934 ] [ RRC reference ]

Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell 2016 165(4) 936-48
[ PubMed ID = 27062922 ] [ RRC reference ]

Ujisawa T, Ohta A, Uda-Yagi M, Kuhara A.
Diverse Regulation of Temperature Sensation by Trimeric G-Protein Signaling in Caenorhabditis elegans.
PLoS One 2016 11(10) e0165518
[ PubMed ID = 27788246 ] [ RRC reference ]

Liu J, Ward A, Gao J, Dong Y, Nishio N, Inada H, Kang L, Yu Y, Ma D, Xu T, Mori I, Xie Z, Xu XZ.
C. elegans phototransduction requires a G protein-dependent cGMP pathway and a taste receptor homolog.
Nat Neurosci 2010 13(6) 715-22
[ PubMed ID = 20436480 ] [ RRC reference ]

Wang D, O'Halloran D, Goodman MB.
GCY-8, PDE-2, and NCS-1 are critical elements of the cGMP-dependent thermotransduction cascade in the AFD neurons responsible for C. elegans thermotaxis.
J Gen Physiol 2013 142(4) 437-49
[ PubMed ID = 24081984 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr Biol 2013 23(11) 1007-12
[ PubMed ID = 23664973 ] [ RRC reference ]

Cao P, Sun W, Kramp K, Zheng M, Salom D, Jastrzebska B, Jin H, Palczewski K, Feng Z.
Light-sensitive coupling of rhodopsin and melanopsin to G(i/o) and G(q) signal transduction in Caenorhabditis elegans.
FASEB J 2012 26(2) 480-91
[ PubMed ID = 22090313 ] [ RRC reference ]

Couto A, Oda S, Nikolaev VO, Soltesz Z, de Bono M.
In vivo genetic dissection of O2-evoked cGMP dynamics in a Caenorhabditis elegans gas sensor.
Proc Natl Acad Sci U S A 2013 110(35) E3301-10
[ PubMed ID = 23940325 ] [ RRC reference ]

Beckert U, Aw WY, Burhenne H, Försterling L, Kaever V, Timmons L, Seifert R.
The Receptor-Bound Guanylyl Cyclase DAF-11 Is the Mediator of Hydrogen Peroxide-Induced cGMP Increase in Caenorhabditis elegans [corrected].
PLoS One 2013 8(8) e72569
[ PubMed ID = 24015261 ] [ RRC reference ]

Bhatla N, Horvitz HR.
Light and hydrogen peroxide inhibit C. elegans Feeding through gustatory receptor orthologs and pharyngeal neurons.
Neuron 2015 85(4) 804-18
[ PubMed ID = 25640076 ] [ RRC reference ]