Mutants (Isolated)

tm3085

Allele Nametm3085
Sequence NameM05B5.6
CGC NameM05B5.6
Worm BaseAllele Name tm3085
CGC Name M05B5.6
Sequence M05B5.6
Phenotypehomozygous viable.
Mutation site11693/11694-12581/12582 (888 bp deletion)
ChromosomeI
Putative gene structurejoin(10297..10445, 10520..10665, 10714..10817, 10860..11015, 11065..11196, 11672..12190, 12263..12427, 12626..12700)
Map position1.83
Balancer
Map position of balancer
Sequence of primersExtRev:TGGCATATCCGTTCCAGCAG,IntRev:ATATCCGTTCCAGCAGCTAC,ExtFwd:GGTTTATACTGCGCCTCAGT,IntFwd:TCTACCTAGTAACTTGCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Koren Y, Sznitman R, Arratia PE, Carls C, Krajacic P, Brown AE, Sznitman J.
Model-independent phenotyping of C. elegans locomotion using scale-invariant feature transform.
PLoS ONE 2015 10(3) e0122326 
[ PubMed ID = 25816290 ] [ RRC reference ]

Wang X, Li G, Liu J, Liu J, Xu XZ.
TMC-1 Mediates Alkaline Sensation in C. elegans through Nociceptive Neurons.
Neuron 2016 91(1) 146-54 
[ PubMed ID = 27321925 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Yeon J, Kim J, Kim DY, Kim H, Kim J, Du EJ, Kang K, Lim HH, Moon D, Kim K.
A sensory-motor neuron type mediates proprioceptive coordination of steering in C. elegans via two TRPC channels.
PLoS Biol. 2018 16(6) e2004929 
[ PubMed ID = 29883446 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]