Mutants (Isolated)

tm3083

Allele Nametm3083
Sequence NameK03E6.4
CGC Namemksr-1
Worm BaseAllele Name tm3083
CGC Name mksr-1
Sequence K03E6.4
Phenotypehomozygous viable.
Mutation site13618/13619-13832/13833 (214 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(12649..12750, 12801..12928, 13397..13527, 13570..13666, 14217..14391, 14837..14893))
Map position-18.74
Balancer
Map position of balancer
Sequence of primersIntRev:GCGATCAGCGTCTGGTATAT,ExtFwd:CGGACGTGGCTTTAAGTAAC,ExtRev:GCGCGATCAGCGTCTGGTAT,IntFwd:CTCAGGTCCGCAGTGCGTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lambacher NJ, Bruel AL, van Dam TJ, Szymańska K, Slaats GG, Kuhns S, McManus GJ, Kennedy JE, Gaff K, Wu KM, van der Lee R, Burglen L, Doummar D, Rivière JB, Faivre L, Attié-Bitach T, Saunier S, Curd A, Peckham M, Giles RH, Johnson CA, Huynen MA, Thauvin-Robinet C, Blacque OE.
TMEM107 recruits ciliopathy proteins to subdomains of the ciliary transition zone and causes Joubert syndrome.
Nat Cell Biol 2016 18(1) 122-31 
[ PubMed ID = 26595381 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Bialas NJ, Inglis PN, Li C, Robinson JF, Parker JD, Healey MP, Davis EE, Inglis CD, Toivonen T, Cottell DC, Blacque OE, Quarmby LM, Katsanis N, Leroux MR.
Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein and two novel MKS1-related (MKSR) proteins.
J Cell Sci 2009 122(Pt 5) 611-24 
[ PubMed ID = 19208769 ] [ RRC reference ]