Mutants (Isolated)

tm3082

Allele Nametm3082
Sequence NameY39A3B.5
CGC Nameckr-2
Worm BaseAllele Name tm3082
CGC Name ckr-2
Sequence Y39A3B.5
Phenotypehomozygous viable. Dr. L. Schoofs: Endocrinology 149, 2826 (2008)
Mutation site32833/32834-33402/33403 (569 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30198..30629, 31620..31710, 31767..31883, 31936..32023, 32608..33082, 33756..33906, 34329..34428, 34649..34808, 35083..35217))
Map position-15.86
Balancer
Map position of balancer
Sequence of primersExtFwd:ACCTGGCGGGGGAAACAACA,IntFwd:CACTCCATCACTACGACAGT,ExtRev:CCGTCAGCGAAATCTATCGT,IntRev:AGATCCCACGCCTACGCAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Janssen T, Meelkop E, Lindemans M, Verstraelen K, Husson SJ, Temmerman L, Nachman RJ, Schoofs L.
Discovery of a cholecystokinin-gastrin-like signaling system in nematodes.
Endocrinology 2008 149(6) 2826-39 
[ PubMed ID = 18339709 ] [ RRC reference ]

Bhattacharya R, Touroutine D, Barbagallo B, Climer J, Lambert CM, Clark CM, Alkema MJ, Francis MM.
A conserved dopamine-cholecystokinin signaling pathway shapes context-dependent Caenorhabditis elegans behavior.
PLoS Genet. 2014 10(8) e1004584 
[ PubMed ID = 25167143 ] [ RRC reference ]

Hu Z, Pym EC, Babu K, Vashlishan Murray AB, Kaplan JM.
A neuropeptide-mediated stretch response links muscle contraction to changes in neurotransmitter release.
Neuron 2011 71(1) 92-102 
[ PubMed ID = 21745640 ] [ RRC reference ]

Matus DQ, Li XY, Durbin S, Agarwal D, Chi Q, Weiss SJ, Sherwood DR.
In vivo identification of regulators of cell invasion across basement membranes.
Sci Signal 2010 3(120) ra35 
[ PubMed ID = 20442418 ] [ RRC reference ]

Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L.
Neuropeptide GPCRs in C. elegans.
Front Endocrinol (Lausanne) 2012 3 167 
[ PubMed ID = 23267347 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]