Mutants (Isolated)

tm3077

Allele Nametm3077
Sequence NameY73B6BL.7
CGC Namecsp-2
Worm BaseAllele Name tm3077
CGC Name csp-2
Sequence Y73B6BL.7
Phenotypehomozygous viable.
Mutation site28927/28928-29244/29245 (317 bp deletion)
ChromosomeIV
Putative gene structurejoin(21611..21668, 21717..21761, 23028..23173, 23521..23670, 23772..23958, 24486..25184, 25323..25400, 25454..25522, 25838..25948, 26210..26320, 28295..28545, 28591..28792, 28840..28934, 28979..29215, 29258..29299)
Map position3.15
Balancer
Map position of balancer
Sequence of primersIntRev:CACGTCATTTCTAGACGTCG,ExtRev:ATACTGATCACCGAGGCCAT,ExtFwd:GCCGGGCTATCATAATTAAC,IntFwd:ACGTTTGGGATATCAGTCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang H, Lu Q, Cheng S, Wang X, Zhang H.
Autophagy activity contributes to programmed cell death in Caenorhabditis elegans.
Autophagy 2013 9(12) 1975-82 
[ PubMed ID = 24185352 ] [ RRC reference ]

Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC.
C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase.
PLoS One 2012 7(5) e36584 
[ PubMed ID = 22590572 ] [ RRC reference ]

Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D.
Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells.
Cell Death Differ 2009 16(10) 1385-94 
[ PubMed ID = 19575016 ] [ RRC reference ]