Mutants (Isolated)

tm3067

Allele Nametm3067
Sequence NameC05C8.9b
CGC Namehyls-1
Worm BaseAllele Name tm3067
CGC Name hyls-1
Sequence C05C8.9b
Phenotypehomozygous viable. Dr. K. Oegema: Genes & Dev. 23, 2046 (2009). Dr. O. Blacque: partially Dyf.
Mutation site13498/13499-13991/13992 (493 bp deletion)
ChromosomeV
Putative gene structurejoin(13542..13638, 13694..13864, 13915..14135)
Map position0.63
Balancer
Map position of balancer
Sequence of primersExtFwd:ACCCCACCATCTTGTGACTG,IntFwd:GTTACGGGTAGTTTAACGTG,ExtRev:AACGTTCTTCCATCGCTACT,IntRev:CATCGCTACTACACAGTCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dammermann A, Pemble H, Mitchell BJ, McLeod I, Yates JR 3rd, Kintner C, Desai AB, Oegema K.
The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation.
Genes Dev. 2009 23(17) 2046-59 
[ PubMed ID = 19656802 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]

Wei Q, Zhang Y, Schouteden C, Zhang Y, Zhang Q, Dong J, Wonesch V, Ling K, Dammermann A, Hu J.
The hydrolethalus syndrome protein HYLS-1 regulates formation of the ciliary gate.
Nat Commun 2016 7 12437 
[ PubMed ID = 27534274 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J. Cell Biol. 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]