Home > Mutants (Isolated) > tm3067

Mutants (Isolated)

Allele Name		tm3067
Sequence Name		C05C8.9b
CGC Name		hyls-1
Worm Base	Allele Name	tm3067
	CGC Name	hyls-1
	Sequence	C05C8.9b
Phenotype		homozygous viable. Dr. K. Oegema: Genes & Dev. 23, 2046 (2009). Dr. O. Blacque: partially Dyf.
Mutation site		13498/13499-13991/13992 (493 bp deletion)
Chromosome		V
Putative gene structure		join(13542..13638, 13694..13864, 13915..14135)
Map position		0.63
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACCCCACCATCTTGTGACTG,IntFwd:GTTACGGGTAGTTTAACGTG,ExtRev:AACGTTCTTCCATCGCTACT,IntRev:CATCGCTACTACACAGTCAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE. Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells. Genetics 2017 207(4) 1423-1440  [ PubMed ID = 29021280 ] [ RRC reference ] Wei Q, Zhang Y, Schouteden C, Zhang Y, Zhang Q, Dong J, Wonesch V, Ling K, Dammermann A, Hu J. The hydrolethalus syndrome protein HYLS-1 regulates formation of the ciliary gate. Nat Commun 2016 7 12437  [ PubMed ID = 27534274 ] [ RRC reference ] Serwas D, Su TY, Roessler M, Wang S, Dammermann A. Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans. J Cell Biol 2017 216(6) 1659-1671  [ PubMed ID = 28411189 ] [ RRC reference ] Dammermann A, Pemble H, Mitchell BJ, McLeod I, Yates JR 3rd, Kintner C, Desai AB, Oegema K. The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation. Genes Dev 2009 23(17) 2046-59  [ PubMed ID = 19656802 ] [ RRC reference ]