Mutants (Isolated)

tm305

Allele Nametm305
Sequence NameF01G4.1
CGC Namepsa-4
Worm BaseAllele Name tm305
CGC Name psa-4
Sequence F01G4.1
Phenotypelethal or sterile?
Mutation site356/357-1144/1145 (788 bp deletion)
ChromosomeIV
Putative gene structurejoin(Z68751:22722..23177, Z68751:23225..23449, Z68751:23497..23723, Z68751:23771..24554, 112..120, 169..1818, 1863..2369, 2415..2900, 2949..3029)
Map position4.86
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtRev:CAGGAGAGATAAGAATGGGG,IntRev:GGTGGGACATATTTATGGTG,ExtFwd:GAATCTTCTGCTGAAACCGT,IntFwd:ATCTGAACGGTATCCTCGCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]