Mutants (Isolated)

tm3040

Allele Nametm3040
Sequence NameY54G2A.25
CGC Namelad-2
Worm BaseAllele Name tm3040
CGC Name lad-2
Sequence Y54G2A.25
Phenotypehomozygous viable. Dr. L. Chen: J. Cell Biol. 180, 233 (2008).
Mutation site224118/224119-224445/224446 (327 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(214208..214285, 215029..215279, 215955..216146, 216197..216352, 216563..216691, 216996..217107, 217364..217554, 217604..217727, 217772..218140, 218590..218723, 218771..218889, 218945..219104, 219519..219639, 223240..223400, 223454..223741, 224310..224594, 224645..224847, 226089..226209, 226993..227063, 227110..227226, 227951..228065, 228111..228177))
Map position-6.72
Balancer
Map position of balancer
Sequence of primersIntFwd:GCTAGCATTGCATTGGTAGA,IntRev:AACTATCCGGAGCCGACACA,ExtFwd:ATCCCAACGGATTGCTAGCA,ExtRev:CCTAGACGATTCCTCCGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang X, Zhang W, Cheever T, Schwarz V, Opperman K, Hutter H, Koepp D, Chen L.
The C. elegans L1CAM homologue LAD-2 functions as a coreceptor in MAB-20/Sema2 mediated axon guidance.
J. Cell Biol. 2008 180(1) 233-46 
[ PubMed ID = 18195110 ] [ RRC reference ]