Mutants (Isolated)

tm3039

Allele Nametm3039
Sequence NameF07A11.3
CGC Namenpp-5
Worm BaseAllele Name tm3039
CGC Name npp-5
Sequence F07A11.3
Phenotypelethal or sterile.
Mutation site13192/13193-A-13716/13717 (524 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(10983..11279, 11336..11581, 11763..12211, 12258..13281, 13334..13540, 13589..13701, 13758..13863))
Map position3.78
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:GGGGGACAATTCTTCCAACT,IntFwd:TCCAGAGCCGCGTGTTCGAT,ExtFwd:ACGAAAGAGCAGAGCCCATA,IntRev:CAACTCCTTCGACGACTCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ródenas E, González-Aguilera C, Ayuso C, Askjaer P.
Dissection of the NUP107 nuclear pore subcomplex reveals a novel interaction with spindle assembly checkpoint protein MAD1 in Caenorhabditis elegans.
Mol. Biol. Cell 2012 23(5) 930-44 
[ PubMed ID = 22238360 ] [ RRC reference ]

Lawrence KS, Chau T, Engebrecht J.
DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity.
PLoS Genet. 2015 11(4) e1005150 
[ PubMed ID = 25898113 ] [ RRC reference ]

Bohr T, Nelson CR, Klee E, Bhalla N.
Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans.
J. Cell Biol. 2015 211(2) 233-42 
[ PubMed ID = 26483555 ] [ RRC reference ]

Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol. 2014 122 277-310 
[ PubMed ID = 24857735 ] [ RRC reference ]