Mutants (Isolated)

tm3036

Allele Name

tm3036

Allele Type

Normal

Sequence Name

F13B10.1b

Gene Name

tir-1

Worm Base

Allele Name

tm3036

Gene Name

tir-1

Sequence

F13B10.1b

Phenotype

homozygous viable. Dr. J. Ewbank: Curr. Biol. 18, 481 (2008).

Mutation site

2308/2309-2577/2578 (269 bp deletion)

Chromosome

III

Putative gene structure

complement(join(1550..1635, 1693..1810, 1967..3001, 4342..4863))

Map position

-4.25

Balancer

Map position of balancer

Sequence of primers

IntRev:AAGTTCGCCTCCGAAGCACT,ExtRev:AAGTGGCCTCCTCTCCAGAC,IntFwd:GCACCCAATCCTCACAGTTA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Czech VL, O'Connor LC, Philippon B, Norman E, Byrne AB.
TIR-1/SARM1 inhibits axon regeneration and promotes axon degeneration.
Elife 2023 12
[ PubMed ID = 37083456 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023
[ PubMed ID = 38045350 ] [ RRC reference ]

Huang T, Suzuki K, Kunitomo H, Tomioka M, Iino Y.
Multiple p38/JNK mitogen-activated protein kinase (MAPK) signaling pathways mediate salt chemotaxis learning in C. elegans.
G3 (Bethesda) 2023 13(9)
[ PubMed ID = 37310929 ] [ RRC reference ]

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716
[ PubMed ID = 37349299 ] [ RRC reference ]

Wang Q, Fu R, Li G, Xiong S, Zhu Y, Zhang H.
Hedgehog receptors exert immune-surveillance roles in the epidermis across species.
Cell Rep 2023 42(8) 112929
[ PubMed ID = 37527037 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Zhang J, Zhao Y, Sun Z, Sun T.
Lacticaseibacillus rhamnosus Probio-M9 extends the lifespan of Caenorhabditis elegans.
Commun Biol 2022 5(1) 1139
[ PubMed ID = 36302976 ] [ RRC reference ]

Teo JH, Kurokawa I, Onishi Y, Sato N, Kitazono T, Tokunaga T, Fujiwara M, Ishihara T.
Behavioral Forgetting of Olfactory Learning Is Mediated by Interneuron-Regulated Network Plasticity in Caenorhabditis elegans.
eNeuro 2022 9(4)
[ PubMed ID = 35977825 ] [ RRC reference ]

Arai M, Kurokawa I, Arakane H, Kitazono T, Ishihara T.
Regulation of Diacylglycerol Content in Olfactory Neurons Determines Forgetting or Retrieval of Olfactory Memory in Caenorhabditis elegans.
J Neurosci 2022 42(43) 8039-8053
[ PubMed ID = 36104280 ] [ RRC reference ]

Madhu B, Lakdawala MF, Issac NG, Gumienny TL.
Caenorhabditis elegans saposin-like spp-9 is involved in specific innate immune responses.
Genes Immun 2020 21(5) 301-310
[ PubMed ID = 32770079 ] [ RRC reference ]

Kew C, Huang W, Fischer J, Ganesan R, Robinson N, Antebi A.
Evolutionarily conserved regulation of immunity by the splicing factor RNP-6/PUF60.
Elife 2020 9
[ PubMed ID = 32538777 ] [ RRC reference ]

Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M.
MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity.
Nat Commun 2020 11(1) 2099
[ PubMed ID = 32350248 ] [ RRC reference ]

Alqadah A, Hsieh YW, Xiong R, Lesch BJ, Chang C, Chuang CF.
A universal transportin protein drives stochastic choice of olfactory neurons via specific nuclear import of a sox-2-activating factor.
Proc Natl Acad Sci U S A 2019 116(50) 25137-25146
[ PubMed ID = 31767767 ] [ RRC reference ]

Verma S, Jagtap U, Goyala A, Mukhopadhyay A.
A novel gene-diet pair modulates C. elegans aging.
PLoS Genet 2018 14(8) e1007608
[ PubMed ID = 30125273 ] [ RRC reference ]

Wang J, Kaletsky R, Silva M, Williams A, Haas LA, Androwski RJ, Landis JN, Patrick C, Rashid A, Santiago-Martinez D, Gravato-Nobre M, Hodgkin J, Hall DH, Murphy CT, Barr MM.
Cell-Specific Transcriptional Profiling of Ciliated Sensory Neurons Reveals Regulators of Behavior and Extracellular Vesicle Biogenesis.
Curr Biol 2015 25(24) 3232-8
[ PubMed ID = 26687621 ] [ RRC reference ]

Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA.
The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons.
Cell Rep 2016 14(7) 1673-1683
[ PubMed ID = 26876181 ] [ RRC reference ]

Kitazono T, Hara-Kuge S, Matsuda O, Inoue A, Fujiwara M, Ishihara T.
Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.
J Neurosci 2017 37(42) 10240-10251
[ PubMed ID = 28924007 ] [ RRC reference ]

Lee KZ, Kniazeva M, Han M, Pujol N, Ewbank JJ.
The fatty acid synthase fasn-1 acts upstream of WNK and Ste20/GCK-VI kinases to modulate antimicrobial peptide expression in C. elegans epidermis.
Virulence 2010 1(3) 113-22
[ PubMed ID = 21178429 ] [ RRC reference ]

Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr Biol 2011 21(23) 1960-7
[ PubMed ID = 22100061 ] [ RRC reference ]

Xie Y, Moussaif M, Choi S, Xu L, Sze JY.
RFX transcription factor DAF-19 regulates 5-HT and innate immune responses to pathogenic bacteria in Caenorhabditis elegans.
PLoS Genet 2013 9(3) e1003324
[ PubMed ID = 23505381 ] [ RRC reference ]