Mutants (Isolated)

tm3036

Allele Nametm3036
Allele TypeNormal
Sequence NameF13B10.1b
Gene Nametir-1
Worm BaseAllele Name tm3036
Gene Name tir-1
Sequence F13B10.1b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Ewbank: Curr. Biol. 18, 481 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2308/2309-2577/2578 (269 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(1550..1635, 1693..1810, 1967..3001, 4342..4863))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AAGTTCGCCTCCGAAGCACT,ExtRev:AAGTGGCCTCCTCTCCAGAC,IntFwd:GCACCCAATCCTCACAGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang J, Zhao Y, Sun Z, Sun T.
Lacticaseibacillus rhamnosus Probio-M9 extends the lifespan of Caenorhabditis elegans.
Commun Biol 2022 5(1) 1139 
[ PubMed ID = 36302976 ] [ RRC reference ]

Teo JH, Kurokawa I, Onishi Y, Sato N, Kitazono T, Tokunaga T, Fujiwara M, Ishihara T.
Behavioral Forgetting of Olfactory Learning Is Mediated by Interneuron-Regulated Network Plasticity in Caenorhabditis elegans.
eNeuro 2022 9(4)  
[ PubMed ID = 35977825 ] [ RRC reference ]

Arai M, Kurokawa I, Arakane H, Kitazono T, Ishihara T.
Regulation of Diacylglycerol Content in Olfactory Neurons Determines Forgetting or Retrieval of Olfactory Memory in Caenorhabditis elegans.
J Neurosci 2022 42(43) 8039-8053 
[ PubMed ID = 36104280 ] [ RRC reference ]

Madhu B, Lakdawala MF, Issac NG, Gumienny TL.
Caenorhabditis elegans saposin-like spp-9 is involved in specific innate immune responses.
Genes Immun 2020 21(5) 301-310 
[ PubMed ID = 32770079 ] [ RRC reference ]

Kew C, Huang W, Fischer J, Ganesan R, Robinson N, Antebi A.
Evolutionarily conserved regulation of immunity by the splicing factor RNP-6/PUF60.
Elife 2020 9  
[ PubMed ID = 32538777 ] [ RRC reference ]

Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M.
MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity.
Nat Commun 2020 11(1) 2099 
[ PubMed ID = 32350248 ] [ RRC reference ]

Alqadah A, Hsieh YW, Xiong R, Lesch BJ, Chang C, Chuang CF.
A universal transportin protein drives stochastic choice of olfactory neurons via specific nuclear import of a sox-2-activating factor.
Proc Natl Acad Sci U S A 2019 116(50) 25137-25146 
[ PubMed ID = 31767767 ] [ RRC reference ]

Verma S, Jagtap U, Goyala A, Mukhopadhyay A.
A novel gene-diet pair modulates C. elegans aging.
PLoS Genet 2018 14(8) e1007608 
[ PubMed ID = 30125273 ] [ RRC reference ]

Wang J, Kaletsky R, Silva M, Williams A, Haas LA, Androwski RJ, Landis JN, Patrick C, Rashid A, Santiago-Martinez D, Gravato-Nobre M, Hodgkin J, Hall DH, Murphy CT, Barr MM.
Cell-Specific Transcriptional Profiling of Ciliated Sensory Neurons Reveals Regulators of Behavior and Extracellular Vesicle Biogenesis.
Curr Biol 2015 25(24) 3232-8 
[ PubMed ID = 26687621 ] [ RRC reference ]

Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA.
The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons.
Cell Rep 2016 14(7) 1673-1683 
[ PubMed ID = 26876181 ] [ RRC reference ]

Kitazono T, Hara-Kuge S, Matsuda O, Inoue A, Fujiwara M, Ishihara T.
Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.
J Neurosci 2017 37(42) 10240-10251 
[ PubMed ID = 28924007 ] [ RRC reference ]

Lee KZ, Kniazeva M, Han M, Pujol N, Ewbank JJ.
The fatty acid synthase fasn-1 acts upstream of WNK and Ste20/GCK-VI kinases to modulate antimicrobial peptide expression in C. elegans epidermis.
Virulence 2010 1(3) 113-22 
[ PubMed ID = 21178429 ] [ RRC reference ]

Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr Biol 2011 21(23) 1960-7 
[ PubMed ID = 22100061 ] [ RRC reference ]

Xie Y, Moussaif M, Choi S, Xu L, Sze JY.
RFX transcription factor DAF-19 regulates 5-HT and innate immune responses to pathogenic bacteria in Caenorhabditis elegans.
PLoS Genet 2013 9(3) e1003324 
[ PubMed ID = 23505381 ] [ RRC reference ]

Inoue A, Sawatari E, Hisamoto N, Kitazono T, Teramoto T, Fujiwara M, Matsumoto K, Ishihara T.
Forgetting in C. elegans is accelerated by neuronal communication via the TIR-1/JNK-1 pathway.
Cell Rep 2013 3(3) 808-19 
[ PubMed ID = 23523351 ] [ RRC reference ]

Hsieh YW, Chang C, Chuang CF.
The microRNA mir-71 inhibits calcium signaling by targeting the TIR-1/Sarm1 adaptor protein to control stochastic L/R neuronal asymmetry in C. elegans.
PLoS Genet 2012 8(8) e1002864 
[ PubMed ID = 22876200 ] [ RRC reference ]

Labed SA, Omi S, Gut M, Ewbank JJ, Pujol N.
The pseudokinase NIPI-4 is a novel regulator of antimicrobial peptide gene expression.
PLoS One 2012 7(3) e33887 
[ PubMed ID = 22470487 ] [ RRC reference ]

Chang C, Hsieh YW, Lesch BJ, Bargmann CI, Chuang CF.
Microtubule-based localization of a synaptic calcium-signaling complex is required for left-right neuronal asymmetry in C. elegans.
Development 2011 138(16) 3509-18 
[ PubMed ID = 21771813 ] [ RRC reference ]

Zugasti O, Bose N, Squiban B, Belougne J, Kurz CL, Schroeder FC, Pujol N, Ewbank JJ.
Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans.
Nat Immunol 2014 15(9) 833-8 
[ PubMed ID = 25086774 ] [ RRC reference ]

Zhang Y, Li W, Li L, Li Y, Fu R, Zhu Y, Li J, Zhou Y, Xiong S, Zhang H.
Structural damage in the C. elegans epidermis causes release of STA-2 and induction of an innate immune response.
Immunity 2015 42(2) 309-320 
[ PubMed ID = 25692704 ] [ RRC reference ]