Mutants (Isolated)

tm3036

Allele Nametm3036
Sequence NameF13B10.1b
CGC Nametir-1
Worm BaseAllele Name tm3036
CGC Name tir-1
Sequence F13B10.1b
Phenotypehomozygous viable. Dr. J. Ewbank: Curr. Biol. 18, 481 (2008).
Mutation site2308/2309-2577/2578 (269 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(1550..1635, 1693..1810, 1967..3001, 4342..4863))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AAGTTCGCCTCCGAAGCACT,ExtRev:AAGTGGCCTCCTCTCCAGAC,IntFwd:GCACCCAATCCTCACAGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Verma S, Jagtap U, Goyala A, Mukhopadhyay A.
A novel gene-diet pair modulates C. elegans aging.
PLoS Genet. 2018 14(8) e1007608 
[ PubMed ID = 30125273 ] [ RRC reference ]

Alqadah A, Hsieh YW, Vidal B, Chang C, Hobert O, Chuang CF.
Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2.
EMBO J. 2015 34(20) 2574-89 
[ PubMed ID = 26341465 ] [ RRC reference ]

Ding W, Smulan LJ, Hou NS, Taubert S, Watts JL, Walker AK.
s-Adenosylmethionine Levels Govern Innate Immunity through Distinct Methylation-Dependent Pathways.
Cell Metab. 2015 22(4) 633-45 
[ PubMed ID = 26321661 ] [ RRC reference ]

Ren Z, Ambros VR.
Caenorhabditis elegans microRNAs of the let-7 family act in innate immune response circuits and confer robust developmental timing against pathogen stress.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(18) E2366-75 
[ PubMed ID = 25897023 ] [ RRC reference ]

Chang C, Hsieh YW, Lesch BJ, Bargmann CI, Chuang CF.
Microtubule-based localization of a synaptic calcium-signaling complex is required for left-right neuronal asymmetry in C. elegans.
Development 2011 138(16) 3509-18 
[ PubMed ID = 21771813 ] [ RRC reference ]

Inoue A, Sawatari E, Hisamoto N, Kitazono T, Teramoto T, Fujiwara M, Matsumoto K, Ishihara T.
Forgetting in C. elegans is accelerated by neuronal communication via the TIR-1/JNK-1 pathway.
Cell Rep 2013 3(3) 808-19 
[ PubMed ID = 23523351 ] [ RRC reference ]

Xie Y, Moussaif M, Choi S, Xu L, Sze JY.
RFX transcription factor DAF-19 regulates 5-HT and innate immune responses to pathogenic bacteria in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003324 
[ PubMed ID = 23505381 ] [ RRC reference ]

Tong A, Lynn G, Ngo V, Wong D, Moseley SL, Ewbank JJ, Goncharov A, Wu YC, Pujol N, Chisholm AD.
Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase.
Proc. Natl. Acad. Sci. U.S.A. 2009 106(5) 1457-61 
[ PubMed ID = 19164535 ] [ RRC reference ]

Ziegler K, Kurz CL, Cypowyj S, Couillault C, Pophillat M, Pujol N, Ewbank JJ.
Antifungal innate immunity in C. elegans: PKCdelta links G protein signaling and a conserved p38 MAPK cascade.
Cell Host Microbe 2009 5(4) 341-52 
[ PubMed ID = 19380113 ] [ RRC reference ]

Pujol N, Cypowyj S, Ziegler K, Millet A, Astrain A, Goncharov A, Jin Y, Chisholm AD, Ewbank JJ.
Distinct innate immune responses to infection and wounding in the C. elegans epidermis.
Curr. Biol. 2008 18(7) 481-9 
[ PubMed ID = 18394898 ] [ RRC reference ]

Pujol N, Zugasti O, Wong D, Couillault C, Kurz CL, Schulenburg H, Ewbank JJ.
Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.
PLoS Pathog. 2008 4(7) e1000105 
[ PubMed ID = 18636113 ] [ RRC reference ]

Hayakawa T, Kato K, Hayakawa R, Hisamoto N, Matsumoto K, Takeda K, Ichijo H.
Regulation of anoxic death in Caenorhabditis elegans by mammalian apoptosis signal-regulating kinase (ASK) family proteins.
Genetics 2011 187(3) 785-92 
[ PubMed ID = 21212236 ] [ RRC reference ]

Kitazono T, Hara-Kuge S, Matsuda O, Inoue A, Fujiwara M, Ishihara T.
Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.
J. Neurosci. 2017 37(42) 10240-10251 
[ PubMed ID = 28924007 ] [ RRC reference ]

Crook-McMahon HM, Oláhová M, Button EL, Winter JJ, Veal EA.
Genome-wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals.
BMC Biol. 2014 12 64 
[ PubMed ID = 25204677 ] [ RRC reference ]

Zhang Y, Li W, Li L, Li Y, Fu R, Zhu Y, Li J, Zhou Y, Xiong S, Zhang H.
Structural damage in the C. elegans epidermis causes release of STA-2 and induction of an innate immune response.
Immunity 2015 42(2) 309-320 
[ PubMed ID = 25692704 ] [ RRC reference ]

Labed SA, Omi S, Gut M, Ewbank JJ, Pujol N.
The pseudokinase NIPI-4 is a novel regulator of antimicrobial peptide gene expression.
PLoS ONE 2012 7(3) e33887 
[ PubMed ID = 22470487 ] [ RRC reference ]

Hsieh YW, Chang C, Chuang CF.
The microRNA mir-71 inhibits calcium signaling by targeting the TIR-1/Sarm1 adaptor protein to control stochastic L/R neuronal asymmetry in C. elegans.
PLoS Genet. 2012 8(8) e1002864 
[ PubMed ID = 22876200 ] [ RRC reference ]

Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr. Biol. 2011 21(23) 1960-7 
[ PubMed ID = 22100061 ] [ RRC reference ]

Lee KZ, Kniazeva M, Han M, Pujol N, Ewbank JJ.
The fatty acid synthase fasn-1 acts upstream of WNK and Ste20/GCK-VI kinases to modulate antimicrobial peptide expression in C. elegans epidermis.
Virulence 2010 1(3) 113-22 
[ PubMed ID = 21178429 ] [ RRC reference ]

Shivers RP, Kooistra T, Chu SW, Pagano DJ, Kim DH.
Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans.
Cell Host Microbe 2009 6(4) 321-30 
[ PubMed ID = 19837372 ] [ RRC reference ]