Home > Mutants (Isolated) > tm3023

Mutants (Isolated)

Allele Name		tm3023
Allele Type		Normal
Sequence Name		F48C11.3
Gene Name		nlp-3
Worm Base	Allele Name	tm3023
	Gene Name	nlp-3
	Sequence	F48C11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14405/14406-14759/14760 (354 bp deletion)
Chromosome		X
Putative gene structure		complement(join(14308..14505, 14579..14653))
Map position		10.24
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTCGCTAGAGTACGTGCTTA,IntFwd:CGGATTAGTGTCCAGTCAGT,ExtRev:CTAGGACTCTCCCGTGCTAT,IntRev:GCAGAGAGTTGCCGGATTAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Huang T, Suzuki K, Kunitomo H, Tomioka M, Iino Y. Multiple p38/JNK mitogen-activated protein kinase (MAPK) signaling pathways mediate salt chemotaxis learning in C. elegans. G3 (Bethesda) 2023 13(9)   [ PubMed ID = 37310929 ] [ RRC reference ] Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S. Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans. Elife 2021 10   [ PubMed ID = 34477553 ] [ RRC reference ] Brewer JC, Olson AC, Collins KM, Koelle MR. Serotonin and neuropeptides are both released by the HSN command neuron to initiate Caenorhabditis elegans egg laying. PLoS Genet 2019 15(1) e1007896  [ PubMed ID = 30677018 ] [ RRC reference ] Cheong MC, Artyukhin AB, You YJ, Avery L. An opioid-like system regulating feeding behavior in C. elegans. Elife 2015 4   [ PubMed ID = 25898004 ] [ RRC reference ] Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y. Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans. PLoS Genet 2013 9(5) e1003472  [ PubMed ID = 23658528 ] [ RRC reference ]