Mutants (Isolated)

tm301

Allele Nametm301
Sequence NameF56C9.1
CGC Namegsp-2
Worm BaseAllele Name tm301
CGC Name gsp-2
Sequence F56C9.1
Phenotypelethal or sterile: Dr. R. Hosono: Exp. Cell Res. 287, 350-360 (2003).
Mutation site31014/31015-AATCATCAGTCGATTTATCT-31335/31336 (321 bp deletion + 20 bp insertion)
ChromosomeIII
Putative gene structurejoin(29773..29824, 29881..30012, 30139..30369, 30428..30642, 30692..30805, 30853..30987, 31217..31339)
Map position-0.73
BalancereT1
Map position of balancer
Sequence of primersExtFwd:GACAAAGGTGCATTGTTACC,IntFwd:CTAGACATGACATGGGGAGA,ExtRev:AACGAAGAGTACGGGATGGA,IntRev:GTGAGGAGTCATTAGCTCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sassa T, Ueda-Ohba H, Kitamura K, Harada S, Hosono R.
Role of Caenorhabditis elegans protein phosphatase type 1, CeGLC-7 beta, in metaphase to anaphase transition during embryonic development.
Exp. Cell Res. 2003 287(2) 350-60 
[ PubMed ID = 12837290 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Chartrand SK, Uchino T, Carlton PM.
Phosphorylation of the synaptonemal complex protein SYP-1 promotes meiotic chromosome segregation.
J. Cell Biol. 2018 217(2) 555-570 
[ PubMed ID = 29222184 ] [ RRC reference ]

Sasagawa Y, Higashitani A, Urano T, Ogura T, Yamanaka K.
CDC-48/p97 is required for proper meiotic chromosome segregation via controlling AIR-2/Aurora B kinase localization in Caenorhabditis elegans.
J. Struct. Biol. 2012 179(2) 104-11 
[ PubMed ID = 22735043 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev. 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]