Mutants (Isolated)

tm3002

Allele Nametm3002
Sequence NameC03D6.6
CGC NameC03D6.6
Worm BaseAllele Name tm3002
CGC Name C03D6.6
Sequence C03D6.6
Phenotypehomozygous viable. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008)
Mutation site715/716-1042/1043 (327 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(350..544, 596..718, 765..864, 911..978))
Map position3.83
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGTCGGAATCCTCGGATGT,ExtRev:CGACTGGATCCTCATCAGTC,IntFwd:TCCTCGGATGTATCGGAATC,IntRev:TTGGGAATGTGGTGACGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev. 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]