Mutants (Isolated)

tm2994

Allele Nametm2994
Sequence NameF36H1.5
CGC NameF36H1.5
Worm BaseAllele Name tm2994
CGC Name F36H1.5
Sequence F36H1.5
Phenotypehomozygous viable
Mutation site7179/7180-7381/7382 (202 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(7022..7185, 7231..7320, 7540..7909))
Map position4.79
Balancer
Map position of balancer
Sequence of primersIntRev:ATGAGTCATGACCCACGCAT,ExtRev:GAAAGCCGCATATTACCGGT,IntFwd:GCCAAGTCCATTTAGTGATC,ExtFwd:AGAGCTACTGTCTACCAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yuan X, Protchenko O, Philpott CC, Hamza I.
Topologically conserved residues direct heme transport in HRG-1-related proteins.
J. Biol. Chem. 2012 287(7) 4914-24 
[ PubMed ID = 22174408 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep. 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]