Mutants (Isolated)

tm2993

Allele Nametm2993
Sequence NameF41E6.4
CGC Namesmk-1
Worm BaseAllele Name tm2993
CGC Name smk-1
Sequence F41E6.4
Phenotypelethal or sterile. Dr. G. Ruvkun: Emb, which is rescued by smk-1 transgene.
Mutation site20597/20598-TTTTT-20972/20973 (375 bp deletion + 5 bp insertion)
ChromosomeV
Putative gene structurejoin(15684..15767, 15995..16420, 16468..16624, 16701..16756, 17101..17163, 19264..19568, 20061..20637, 20687..20941, 20987..21895, 21945..22085, 22617..22961)
Map position1.49
BalancernT1
Map position of balancer
Sequence of primersExtFwd:CGACAATGCGGCCGGATTAT,IntFwd:GAAGTTTTCCGGATGTGCGA,ExtRev:ACCGATTGACGATTGGCAAT,IntRev:CGGGATCTAGCAGAGTTTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sen I, Zhou X, Chernobrovkin A, Puerta-Cavanzo N, Kanno T, Salignon J, Stoehr A, Lin XX, Baskaner B, Brandenburg S, Björkegren C, Zubarev RA, Riedel CG.
DAF-16/FOXO requires Protein Phosphatase 4 to initiate transcription of stress resistance and longevity promoting genes.
Nat Commun 2020 11(1) 138 
[ PubMed ID = 31919361 ] [ RRC reference ]