Mutants (Isolated)

tm2990

Allele Nametm2990
Sequence NameF18E9.2
CGC Namenlp-7
Worm BaseAllele Name tm2990
CGC Name nlp-7
Sequence F18E9.2
Phenotypehomozygous viable. Dr. Y. Iino: normal chemotaxis to NaCl, normal salt chemotaxis learning. Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response.
Mutation site29985/29986-30220/30221 (235 bp deletion)
ChromosomeX
Putative gene structurejoin(29870..29937, 30086..30118, 30169..30288, 30342..30486)
Map position0.15
Balancer
Map position of balancer
Sequence of primersExtFwd:GACCTGATATGTGCTGAGAT,IntFwd:CTCTGTTTAGCCTATCACCA,ExtRev:GCTAGTGAAGGGAGGATCAT,IntRev:CAAGTACTAGTACCTCGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Park SK, Link CD, Johnson TE.
Life-span extension by dietary restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C. elegans.
FASEB J. 2010 24(2) 383-92 
[ PubMed ID = 19783783 ] [ RRC reference ]

Takayama J, Faumont S, Kunitomo H, Lockery SR, Iino Y.
Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans.
Nucleic Acids Res. 2010 38(1) 131-42 
[ PubMed ID = 19875417 ] [ RRC reference ]