Mutants (Isolated)

tm2988

Allele Nametm2988
Sequence NameW09C5.4
CGC Nameins-33
Worm BaseAllele Name tm2988
CGC Name ins-33
Sequence W09C5.4
Phenotypehomozygous viable. Dr. J. Kaplan: weak Hic. Dr. T. Katada: normal germline proliferation during L1 diapause.
Mutation site10824/10825-11019/11020 (195 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(9848..9930, 10877..11168))
Map position21.61
Balancer
Map position of balancer
Sequence of primersExtRev:GCCGTATATCTCGGCGGAGA,IntFwd:TAACTCTGCGGGGAGGCAAG,IntRev:CAGCAGCACTTTCACCGTAA,ExtFwd:CTATCTCTCCTCCCCACCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Michaelson D, Korta DZ, Capua Y, Hubbard EJ.
Insulin signaling promotes germline proliferation in C. elegans.
Development 2010 137(4) 671-80 
[ PubMed ID = 20110332 ] [ RRC reference ]

Chen X, Chalfie M.
Modulation of C. elegans touch sensitivity is integrated at multiple levels.
J. Neurosci. 2014 34(19) 6522-36 
[ PubMed ID = 24806678 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat. Cell Biol. 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J. 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]