Mutants (Isolated)

tm2986

Allele Nametm2986
Sequence NameY59A8B.14
CGC Namepar-4
Worm BaseAllele Name tm2986
CGC Name par-4
Sequence Y59A8B.14
Phenotypehomozygous viable
Mutation site[Y37H2A] 1938/1939-[Y37H2A] 2260/2261 (322 bp deletion)
ChromosomeV
Putative gene structurejoin(AL132898.2:169131..169275, AL132898.2:169961..170070, AL132898.2:170588..170701, AL132898.2:171978..172088, AL132898.2:172142..172408, AL132898.2:173522..173791, AL132898.2:174098..174180, 89..250, 1455..1548, 1609..1780, 1963..2288)
Map position14.07
Balancer
Map position of balancer
Sequence of primersExtRev:GAGGCTAGGTGGCCAGACTA,IntRev:GTGGCCAGACTACAAACTAC,ExtFwd:GGATCAAGGCCTTGGCCGTA,IntFwd:GCCTTGGCCGTATAATGGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hwang AB, Ryu EA, Artan M, Chang HW, Kabir MH, Nam HJ, Lee D, Yang JS, Kim S, Mair WB, Lee C, Lee SS, Lee SJ.
Feedback regulation via AMPK and HIF-1 mediates ROS-dependent longevity in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(42) E4458-67 
[ PubMed ID = 25288734 ] [ RRC reference ]