Mutants (Isolated)

tm2984

Allele Nametm2984
Sequence NameF18E9.2
CGC Namenlp-7
Worm BaseAllele Name tm2984
CGC Name nlp-7
Sequence F18E9.2
Phenotypehomozygous viable. Dr. Y. Iino: normal chemotaxis to NaCl, normal salt chemotaxis learning. Dr. J. Kaplan: slight increase in Nile Red staining. Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response. Dr. I. Mori: thermotaxis assay impossible, Unc.
Mutation site29274/29275-31032/31033 (1758 bp deletion)
ChromosomeX
Putative gene structurejoin(29870..29937, 30086..30118, 30169..30288, 30342..30486)
Map position0.15
Balancer
Map position of balancer
Sequence of primersIntFwd:GATCAAAGGAACGGGCCCAA,ExtRev:CGCAGGAGGTTTTCTGGGCA,ExtFwd:GCGAACTCGGTTATTAGTGA,IntRev:ACGAATATAGTTGCTCCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Castelein N, Cai H, Rasulova M, Braeckman BP.
Lifespan regulation under axenic dietary restriction: a close look at the usual suspects.
Exp. Gerontol. 2014 58 96-103 
[ PubMed ID = 25066271 ] [ RRC reference ]

Mendenhall AR, Wu D, Park SK, Cypser JR, Tedesco PM, Link CD, Phillips PC, Johnson TE.
Genetic dissection of late-life fertility in Caenorhabditis elegans.
J. Gerontol. A Biol. Sci. Med. Sci. 2011 66(8) 842-54 
[ PubMed ID = 21622982 ] [ RRC reference ]

Park SK, Link CD, Johnson TE.
Life-span extension by dietary restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C. elegans.
FASEB J. 2010 24(2) 383-92 
[ PubMed ID = 19783783 ] [ RRC reference ]

Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM.
Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior.
PLoS Genet. 2017 13(4) e1006697 
[ PubMed ID = 28384151 ] [ RRC reference ]

Harris G, Shen Y, Ha H, Donato A, Wallis S, Zhang X, Zhang Y.
Dissecting the signaling mechanisms underlying recognition and preference of food odors.
J. Neurosci. 2014 34(28) 9389-403 
[ PubMed ID = 25009271 ] [ RRC reference ]

Takayama J, Faumont S, Kunitomo H, Lockery SR, Iino Y.
Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans.
Nucleic Acids Res. 2010 38(1) 131-42 
[ PubMed ID = 19875417 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr. Biol. 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell. 2016 39(2) 209-223. 
[ PubMed ID = -1 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]