Mutants (Isolated)

tm2983

Allele Nametm2983
Sequence NameR10H10.1
CGC Namelpd-8
Worm BaseAllele Name tm2983
CGC Name lpd-8
Sequence R10H10.1
Phenotypelethal or sterile
Mutation site6304/6305-6892/6893 (588 bp deletion)
ChromosomeIV
Putative gene structurejoin(5977..6013, 6057..6119, 6166..6244, 6309..6798)
Map position4.58
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtRev:TTTGGACTGGGCCGTTGAAC,IntFwd:CCGGAGCTTTGTACAAGCAG,IntRev:GACTGGGCCGTTGAACTTTG,ExtFwd:GCTCACAAGACTGAACCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK.
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis.
Cell 2019 177(6) 1507-1521.e16 
[ PubMed ID = 31031004 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]