Mutants (Isolated)

tm2976

Allele Nametm2976
Sequence NameM7.5
CGC Nameatg-7
Worm BaseAllele Name tm2976
CGC Name atg-7
Sequence M7.5
Phenotypelethal or sterile. Dr. H. Zhang: accumulation of several germline P granule components in somatic cells. Dr. O. Blacque: could not assess Dyf.
Mutation site310/311-CGCTTTTTTGC-572/573 (262 bp deletion + 11 bp insertion)
ChromosomeIV
Putative gene structurejoin(complement(929..1055), complement(713..879), complement(514..666),complement(106..463), complement(AL032641.1:18225..18397), complement(AL032641.1:17588..18181), complement(AL032641.1:17365..17535), complement(AL032641.1:17115..17315))
Map position4.83
BalancernT1
Map position of balancer
Sequence of primersExtFwd:TCTGAGCTCCATCTGCTGAG,IntFwd:CTGCTGAGCATTCAGCACTC,ExtRev:TGGCGGTCTGAGAATCCTGA,IntRev:ATGGCCACGTTTGTTCCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Erdélyi P, Borsos E, Takács-Vellai K, Kovács T, Kovács AL, Sigmond T, Hargitai B, Pásztor L, Sengupta T, Dengg M, Pécsi I, Tóth J, Nilsen H, Vértessy BG, Vellai T.
Shared developmental roles and transcriptional control of autophagy and apoptosis in Caenorhabditis elegans.
J. Cell. Sci. 2011 124(Pt 9) 1510-8 
[ PubMed ID = 21502138 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev. Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Zhang Y, Yan L, Zhou Z, Yang P, Tian E, Zhang K, Zhao Y, Li Z, Song B, Han J, Miao L, Zhang H.
SEPA-1 mediates the specific recognition and degradation of P granule components by autophagy in C. elegans.
Cell 2009 136(2) 308-21 
[ PubMed ID = 19167332 ] [ RRC reference ]